Supplemental Lecture (97/02/05 update) by Stephen T. Abedon (abedon.1@osu.edu)
- Chapter title: Nucleic Acids
- A list of vocabulary words is found toward the end of this document
- Protein molecules are certainly very complex. To some extent, though, the structural complexity of proteins is rivaled only by the structural complexity of certain nucleic acid polymers known as RNA. Interestingly, the number of RNA building blocks (four) is small compared with the number of protein building blocks (20). In fact, the structural diversity within RNA building blocks itself pales against that among amino acids. Nonetheless, because of strong and well defined hydrogen bonding between RNA building blocks, RNA molecules are capable of intricate folding that lies at the root of their structural complexity. Perhaps most surprising of all, the information that ultimately defines the complexity of both protein and RNA molecules is coded by a structurally much less complex nucleic acid polymer known as DNA.
- Nucleic acid
- Nucleic acids
are a category of organic compounds found in great abundance in their namesake: The nucleus of eucaryotic cells.
- Both DNA and RNA are nucleic acids.
- Structure:
- Nucleic acid
polymers consist of a backbone plus R groups, the latter called nitrogenous bases.
- The backbone consists of alternating five-ringed sugars and phosphate groups.
- See the figure below for a better idea of what this backbone looks like (NB, below, stands for nitrogenous base). You should be sufficiently familiar with this figure (or its equivalent) to be able to note discrepancies from its structure (by the way, the following is a rendering of RNA).
- See also text figure 1040.1.
NB NB
| |
C C
/ \ / \
O C - OH O C - OH
| | | |
Pi - C - C - C - Pi - C - C - C – Pi
Nitrogenous bases can hydrogen bond complementary bases (base pairing) found either:
- in other nucleic acid polymers,
- in nucleic acid monomers, or
- in different parts of the same nucleic acid polymer, sufficiently far down the backbone that the chain is able to double-back upon itself.
See illustration below.
Illustration, hydrogen bonding within and between nucleic acids

DNA (deoxyribonucleic acid)
- A nucleic acid. In most organisms DNA is the substance from which genes are made, i.e., the hereditary material.
- The nitrogenous bases associated with DNA include adenine (A), guanine (G), cytosine (C), and thymine (T).
RNA (ribonucleic acid)
- A nucleic acid. In most organisms RNAs are templated products of DNA genes.
- Types of RNAs include messenger RNA, ribosomal RNA, and transfer RNA.
- RNA
serves as the hereditary material in some viruses.
- The nitrogenous bases associated with RNA include adenine (A), guanine (G), cytosine (C), and uracil (U).
- U replaces T:
- Note that RNA contains uracil while DNA contains the otherwise equivalent thymine.
- The reason for this interchange may be because uracil is energetically cheaper to produce than thymine, but less stable. Thus, thymine is more appropriately used in the long-lived, low-copy number DNA, while uracil is more appropriately used in the short-lived, high-copy number RNA.
Nucleotide
- The building blocks of nucleic acids.
- Are either ribonucleotides or deoxyribonucleotides depending on whether they are used in the synthesis of DNA or in the synthesis of RNA, respectively.
- Different sugars:
- Ribonucleotides
or deoxyribonucleotides are distinguishable by their 5-carbon sugars. Ribonucleotides utilize the sugar ribose.
- Deoxyribonucleotides
utilize the sugar deoxyribose.
- Shown below is a ribonucleotide and a deoxyribonucleotide, respectively. Note their structural similarities as well as their differences (the latter in bold):
H
HC-O-Pi
|
| O
C-' '-C -(nitrogenous base)
H\ H H / H
C - C
| |
OH OH
H
HC-O-Pi
|
| O
C-' '-C -(nitrogenous base)
H\ H H / H
C - C
| |
OH H
5' to 3' polarity
As with peptides, nucleic acid chains display polarity. This polarity is expressed in terms of two of the carbon atoms found in the ribose and deoxyribose sugars.
Particularly, starting to the right of the oxygen member of the ring and working around the ring clockwise, the carbon atoms are number 1', 2', 3' and 4' (the carbon found above the ring is numbered 5'). These numbers are primed because not primed numbers are used to name the carbons found in the nitrogenous bases.
NB NB
| |
C C 1'
/ \ / \ 2'
O C - OH O C - OH
| | | |
Pi - C - C - C - Pi - C - C - C - OH
5' 4' 3' 5' 4' 3'
Note, however, that strictly only carbons 3', 4', and 5' are found in the nucleic acid backbone. Nucleic acids consequently can be described as having a 3' to 5', or 5' to 3' polarity. A longer nucleic acid strand would thus look like this:
NB NB NB NB NB
| | | | |
C C C C C
O C O C O C O C O C
Pi-C-C-C-Pi-C-C-C-Pi-C-C-C-Pi-C-C-C-Pi-C-C-C-OH
5'4'3' 5'4'3' 5'4'3' 5'4'3' 5'4'3'
and might be abbreviated like this:
5' Pi-------------------------------------------------OH 3'
In fact, when the sequence of nucleotides in a nucleic acid polymer are described, they are written, by convention, in the 5' to 3' direction (which is the direction that DNA is synthesized by cells).
Double helix [double stranded]
- Double helix
is a phrase so common that it's almost a cliché. (I even heard once of a pop band named helix--apparently they were looking for a name for their band by leafing through a science text and voila!)
- What does it mean? Double helix describes one of the structures that two strands of DNA or RNA may assume following hydrogen bonding between the nitrogenous bases of their constituent building blocks.
- See also text figure 1040.2.
Antiparallel arrangement (of double helix)
- Strands of nucleic acids have their sugar-phosphate backbones arranged in opposite directions within a double helix, thus making them antiparallel.
- Particularly, an antiparallel double helix has its two constituent strands arranged as follows:
5' Pi-------------------------------------------------OH 3'
| | | | | | | | | | | | | | | | | | | | | | | |
3' HO-------------------------------------------------Pi 5'
- Represented in three dimensions, of course, the two strands would be twisted around each other to the extent hydrogen bonding between bases allows (e.g., to form a double helix).
- Note how in the representation above the hydrogen bonded nitrogenous base pairs are represented by the rungs on a ladder, which connect a highly simplified representation of sugar-phosphate backbones. Below I don't even bother to represent the nitrogenous bases or terminal -OH groups:
- lot's implied/not shown:
5' ------------------------------------------------- 3'
3' ------------------------------------------------- 5'
- Nevertheless, there is enough information in the above representation for you to know exactly what is being described (i.e., hydrogen bonded, antiparallel nucleic acid polymers; though you can't tell unless you are told, or have some other clues, whether this is RNA or DNA being represented).
Base pairing
- Bonding between bases:
- With a double helix the two strands of neucleic acid are hydrogen bonded together through their respective nitrogenous bases.
- The bonding which occurs is specific such that one kind of nitrogenous base will hydrogen bond with only one other type of nitrogenous base.
- In DNA, adenine will hydrogen bond only with thymine while guanine will hydrogen bond only with cytosine, and vice versa.
- In RNA, adenine will hydrogen bond only with uracil while guanine again will hydrogen bond only with cytosine, and vice versa.
- When RNA binds to DNA, adenine from the RNA hydrogen bonds with thymine from the DNA while uracil from the RNA hydrogen bonds with adenine from the DNA.
Sequence complementarity [within double helix; complementary strand]
- The base paired nucleotides A, T, G, and C in DNA or A, U, G, and C in RNA are arrayed on antiparallel strands in a complementary pattern reflecting the limited base pairing possibilities between nitrogenous bases. Thus, a double helix may be represented as follows:
5' AGTCGATCGGGGGTACCGATCGGGATCCTTTTATATATAGGAAAAGCTG 3'
3' TCAGCTAGCCCCCATGGCTAGCCCTAGGAAAATATATATCCTTTTCGAC 5'
- In this representation (above), base paired nucleotides are shown adjacent (i.e., one below the other) and individual nucleotides are described as individual letters (AGTC). Note that the above representation is of double stranded DNA. Note also that each strand is complementary to the other in terms of sequence, and thus each is the other's complementary strand.
5' AGTCGATCGGGGGTACCGATCGGGATCCTTTTATATATAGGAAAAGCTG 3'
3' UCAGCUAGCCCCCAUGGCUAGCCCUAGGAAAAUAUAUAUCCUUUUCGAC 5'
- In the above representation a strand RNA is shown bound to a strand of DNA. How can you tell this? Which strand is the RNA? Note that, in both of these examples, no base pairings are shown except the following: A:T, A:U, and G:C. These are the base pairings that stably occur between antiparallel strands of nucleic acids.
Single stranded
- The two complimentary strands of DNA below are not bound:
3' AGTCGATCGGGGGTACCGATCGGGATCCTTTTATATATAGGAAAAGCTG 5'
3' CAGCTTTTCCTATATATAAAAGGATCCCGATCGGTACCCCCGATCGACT 5'
- (How can you tell this is true?). Therefore they do not form a double helix. Instead, each represents an individual, single strand of DNA.
- DNA tends to form double helices when a complementary strand is present so we can assume that it would be unstable for these two strands to remain single stranded (since, if you check, you will observe that the above two strands are complementary, but arranged in parallel rather than antiparallel).
- Note that it is usually (though certainly not always) DNA that is being referred to when a distinction between single stranded and double stranded is made. This is because DNA tends to be found in double helices consisting of two individual strands, while RNA tends to be found as single strands. Thus, when DNA is single stranded it is an unusual occurrence and one tends to call attention to it by distinguishing it from double stranded DNA.
ATP [adenosine triphosphate]
- Carrier of readily available chemical energy:
- The principle energy carrying molecule of all cells.
- "ATP is called a high-energy molecule because it releases a large amount of usable energy when it loses" one of its phosphate groups:
- Structure:
- ATP
consists of the ribonucleotide adenine to which two additional phosphate groups have been added to the one already present.
- See particularly the placement of the phosphates
- in
- text figure 1040.3.
ATP + H2O ß à ADP + Pi + Energy.
A second reason for this designation (high-energy molecule) is that it does not require large amounts of activation energy to induce the hydrolysis of ATP to ADP. Thus, ATP represents a significant amount of potential energy which is available more or less on demand.
ATP hydrolysis coupled with energy requiring reactions (e.g., anabolism):
This energy stored by ATP is particularly employed to drive reactions or processes (i.e., as in coupled reactions) than cannot occur without an input of energy.
"Although the high-energy bond of ATP is not highly energetic in an absolute sense--it is not nearly as (energetic) as a carbon-hydrogen bond--it is more energetic than the activation energies of almost all energy-requiring cell activities, and that is why it is able to serve as a universal energy donor." (p. 147, Raven & Johnson, 1995
Note that the energy required to drive the reverse reaction (i.e., the synthesis of ATP from ADP, Pi, and energy) is supplied by the decomposition of organic compounds such as glucose.
Links
The RNA Page
Mike Zuker's RNA Page
The RNA World at IMB Jena
Szostak RNA Related Bookmarks
Chromosome to DNA (Molecular Biology for Beginners)
DNA structure (Molecular Biology for Beginners)
RNA Structure (Molecular Biology for Beginners)
Caveats
- Figure 3.21 on page 56 of Raven & Johnson, 1995 is misleading since the same sugar is shown to represent both RNA and DNA (and the sugar is shown without its fifth carbon which should fall between the sugar and the phosphate group). In fact, it is a deoxyribonucleotide which is shown in this figure. A ribonucleotide would have a second -OH group just to the right of the one shown.
- Figure 3.21 on page 56 as well as Figure 3.22 on page 57 of Raven & Johnson, 1995 is also misleading because the fifth carbon (the one not in the ring) of ribose and/or deoxyribose is not shown.
- Technically the nitrogenous base in this figure is drawn incorrectly--there are more Ns in the ring than shown; see figure 3.22 on p. 57 of Raven & Johnson, 1995).
Vocabulary
- 5' to 3' polarity
- A
- Adenine
- ATP
- Adenosine triphosphate
- Base pairing
- C
- Cytosine
- Deoxyribonucleic acid
- Deoxyribonucleotide
- DNA
- Double helix
- Double stranded DNA
- G
- Guanine
- Hydrogen bonding within and between nucleic acids, illustration
- Nitrogenous base
- Nucleic acid
- Nucleotide
- Ribonucleic acid
- Ribonucleotide
- RNA
- Single stranded DNA
- T
- Thymine
- U
- Uracil
Practice questions
- An adenine can stably base pair to a(n) ______ found in the antiparallel strand of nucleic acids. (circle correct answer) [PEEK]
- guanine
- adenine
- thymine
- cytosine
- all of the above
- none of the above
- If the following strands are hydrogen bonded together, find and circle the error in the bottom strand: [PEEK]
5' HO-GGACATCGATTCAGAGAGGAATTGCTACGTACCC-OH 3'
3' HO-CCTGTAGCTAAGTCTCTCGTTAACGATGCATGGG-OH 5'
- ATP (circle correct answer) [PEEK]
- contains a single high energy bond found between two phosphates
- is basically a deoxyribonucleotide
- contains three adenines linked end to end
- is negatively charged
- all of the above
- none of the above
- Name each of the five carbon atoms shown: [PEEK]

- Circle the error: [PEEK]
5' AGTCGATCGGGGGTACCGATCGGGATCCTTTTATATATAGGAAAAGCTG 3'
3' UCAGCTAGCCCCCAUGGCUAGCCCUAGGAAAAUAUAUAUCCUUUUCGAC 5'
- All of the reasonably complex biomolecules (3 atoms) we have studies so far in this course have a number of things in common. Name two (other than their all being, for example, complex biomolecules). [PEEK]
- __________ is not a property of DNA which distinguishes it from RNA. (circle one correct answer) [PEEK]
- usually double stranded.
- missing one -OH group on sugar.
- positively charged backbone.
- employs thymine instead of uracil.
- all of the above are not distinguishing properties.
- all of the above are distinguishing properties.
- The __________ carbon of ribose in ATP is bonded to a phosphate group. (circle one correct answer) [PEEK]
- 1
- 2
- 3
- 4
- 5
- 6
- 1'
- 2'
- 3'
- 4'
- 5'
- 6'
- none of the above
- What kind of molecule is typically found as a double helix. Be specific [PEEK]
- Enter one appropriate Roman numeral in each of the blanks below: (a) energy storage, (b) enzymes, (c) heredity, (d) glucose: (fill in blanks appropriately; do not use numerals more than once) [PEEK]
- _____ carbohydrate.
- _____ lipid.
- _____ protein.
- _____ nucleic acid.
- Name the three chemical components of all nucleotides. You don't have to be terribly specific. For example, to answer a similar question referring to a simple phospholipid you might say: glycerol (1), fatty acid (2), and a phosphate group. [PEEK]
Practice question answers
- iii, thymine
- 16th base from the left. It is a G and should be a C:
|
5' HO-GGACATCGATTCAGAGAGGAATTGCTACGTACCC-OH 3'
3' HO-CCTGTAGCTAAGTCTCTCGTTAACGATGCATGGG-OH 5'
|
iv, is negatively charged
- starting at the Pi, 5', 4', 3' ,2' ,1'.

- the first T on the bottom strand starting from the left
- all: are dissolved or suspended in water, contain carbon atoms, contain hydrogen atoms, have carbon to carbon bonds, have carbon to hydrogen bonds, contain oxygen atoms, have carbon to oxygen bonds, contain reduced carbons, contain obtainable chemical energy, can be burned in air, are synthesized by cells, are synthesized by enzymes, others?
- iii, positively charged backbone. Both have negatively charged backbone.
- xi, 5' carbon.
- DNA
- i:d, ii:a, iii:b, iv:c.
- phosphate group, sugar (ribose or deoxyribose), nitrogenous base.
References
- Keeton, W.T. (1980). Biological Science. Third Edition. W.W. Norton & Co., New York. pp. 46-65.
- McMurry, J. (1984). Organic Chemistry. Second Edition. Brooks/Cole Publishing Co., Pacific Grove, CA. p. 85.
- Raven, P.H., Johnson, G.B. (1995). Biology (updated version). Third Edition. Wm. C. Brown publishers, Dubuque, Iowa. pp. 56-59, 146-148.
- Tortora, G.J., Funke, B.R., Case, C.L. (1995). Microbiology. An Introduction. Fifth Edition. The Benjamin/Cummings Publishing, Co., Inc., Redwood City, CA, pp. 35-51.