- Viruses of Fungi and Lower Eukaryotes. Anonymous (1995). [TOP OF PAGE]
- Relationships of tailed phages: a survey of protein sequence identity. Ackermann, H.-W., Elzanowski, A., Fobo, G., Stewart, G. (1995). Archives of Virology 140:1871-1884. [TOP OF PAGE]
- A Bacillus phage that is a living fossil. Ackermann, H.-W., Yoshino, S., Ogata, S. (1995). Canadian Journal of Microbiology 41:294-297. Bacillus cereus phage Bace-11 has an isometric head and a contractile tail of about 500 nm in length, and is one of the two largest bacterial viruses known. Its tail, characterized by three long, whiplike fibers, is identical to giant phage tails produced by a Clostridium strain. These particles may represent phages of ancient origin that arose before the divergence of clostridia and bacilli. [TOP OF PAGE]
- Microbiological quality of raw cow's milk at collection centers in Trinidad. Adesiyun, A.A., Webb, L., Rahaman, S. (1995). Journal of Food Protection 58:139-146. The microbial quality, pH and presence of selected pathogens in milk at eight collection centers in Trinidad were determined. The enterotoxigenicity and susceptibility of Staphylococcus aureus strains to antimicrobial agents and bacteriophages were investigated while the antibiograms and ability of Escherichia coli isolates to agglutinate O157 antiserum were also assessed. Of the 287 milk samples tested, the mean pH was 6.80 +- 0.10 and 207 (72.1%) were California mastitis test (CMT) positive. All (100.0%) milk samples contained S. aureus, and 217 (75.6%) were positive for E. coli. The ranges of mean counts per ml for total aerobic bacteria, S. aureus and E. coli were 3.3 yen 10-6 to 9.8 yen 10-7, 1.4 yen 10-4 to 1.2 yen 10-5 and 4.2 yen 10-4 to 1.6 yen 10-6, respectively. Ninety-three (40.4%) of 230 strains of S. aureus tested were enterotoxigenic producing staphylococcal enterotoxins A, B, C, D or a combination with SEC being predominantly elaborated. Of the 245 strains of S. aureus phage-typed, 123 (50.2%) were susceptible to international phage set (IPS) of bacteriophages. Overall, 49 (49.0%) of 100 strains of S. aureus tested were resistant to 1 or more of the 8 antimicrobial agents with resistance high to penicillin (48.0%), ampicillin (45.0%) and methicillin (21.0%). Among 100 strains of E. coli tested, 98 (98.0%) exhibited resistance to antimicrobial agents with high prevalence of resistance detected for cephalothin (79.0%), ampicillin (73.0%) and streptomycin (47.0%). Thirteen (6.9%) of 188 strains of E. coli agglutinated with O157 antiserum. It was concluded that the presence of some pathogens in milk in fairly high counts coupled with toxigenicity of some strains pose a health hazard to consumers. [TOP OF PAGE]
- Characteristics of Staphylococcus aureus strains isolated from bovine mastitic milk: Bacteriophage and antimicrobial agent susceptibility, and enterotoxigenicity. Adesiyun, A.A. (1995). Journal of Veterinary Medicine Series B 42:129-139. Staphylococcus aureus strains isolated from bovine mastitic milk in Trinidad were examined for their susceptibility to bacteriophages and antimicrobial agents and their ability to produce enterotoxins. Phage 42D was used to screen for bovine strains of S. aureus in milk. Of 250 strains tested, 224 (89.6%) were sensitive to phages in the international phage set (IPS), 85 (34.0%) were resistant to antimicrobial agents and 134 (53.6%) were enterotoxigenic. Strains lysed by phages in various groups (mixed) were prevalent, 145 (58.0%), followed by strains sensitive to groups III (17.0%) and 1 (8.8%) phages. A total of 72 (28.8%) strains were used by phage 42D either alone or with others. Resistance to penicillin was most common with 59 (23.6%) strains while 44 (17.6%) and 43 (17.2%) strains were resistant to ampicillin and triple sulphur respectively. Only 3 (1.2%) strains were resistant to methicillin. Prevalence of resistance to penicillin (12.5%) amongst phage 42D-sensitive strains was significantly (P ltoreq 0.01; X-2) lower than for strains not lysed by phage 42D (28.1%) but strains susceptible to phage 42D were significantly (P ltoreq 0. 05; X-2)more resistant (4.2%) to methicillin than those not lysed by the phage (0.0%). Amongst 134 enterotoxigenic strains, 32 (23.9%), 77 (57.5%), 67 (50.0%) and 21 (15.7%) produced staphylococcal enterotoxins A(SEA), B(SEB), C(SEC) and D(SED) respectively either alone or mixed. SEB and SEC were significantly (P ltoreq 0.01; X-2) more produced than either SEA or SED. Strains lysed by groups IV, i.e. 42D (62.5%), and III (56.7%) were more enterotoxigenic than those sensitive to phages in groups II (45.5%) and non-typeable (46.2%) but the differences were not statistically significant (P ltoreq 0.05; X-2). Strains lysed by group II phages (72.7%) were significantly (P lt EQ 0.05; X-2) more resistant to antimicrobial agents than those lysed by phage 42D (18.8%). It was concluded that bovine mastitis strains of S. aureus in Trinidad were highly susceptible to bacteriophages and antimicrobial agents and enterotoxigenic and less than one-third may be considered to be bovine strains. [TOP OF PAGE]
- Kinetics of pathogen destruction during storage of dewatered biosolids. Ahmed, A.U., Sorensen, D.L. (1995). Water Environment Research 67:143-150. The kinetics of pathogen destruction were determined during storage of digested and dewatered wastewater treatment biosolids to obtain relationships between temperature and duration of biosolids storage. Biosolids, seeded with Salmonella typhimurium, Yersinia enterocolitica. Campylobacter jejuni, bacteriophage f2, poliovirus, and Ascaris suum eggs were incubated at 5degree, 22degree, 38degree, and 49.5degree C, under both aerobic and anaerobic conditions for up to 62 days. Destruction of pathogens in stored biosolids occurred at all temperatures examined; however, rates increased with increasing temperature. There was no significant difference between the destruction of pathogens under aerobic or anaerobic conditions at all temperatures studied. At 50degree C, the decay rate of S. typhimurium, Y. enterocolitica, bacteriophage f2, poliovirus, and A. suum eggs was estimated to be 1.13, 1.10, 1.54, 0.81, and 0.21 log10 reductions per day, respectively. [TOP OF PAGE]
- Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. Ahmed, R., Sankar-Mistry, P., Jackson, S., Ackermann, H.-W., Kasatiya, S.S. (1995). Journal of Clinical Microbiology 33:636-640. Bacillus cereus is responsible for an increasing number of food poisoning cases. By using 12 bacteriophages isolated from sewage, a typing scheme for B. cereus isolates from outbreaks or sporadic cases of food poisoning was developed. The phages belonged to three morphotypes. Ten phages with contractile tails and icosahedral heads were members of the Myoviridae family, and two phages with noncontractile tails belonged to the Siphoviridae family. Phage II represented a new species. It had an isometric head and a very long contractile tail with long wavy tail fibers and was one of the largest viruses known. The vast majority of 166 B. cereus strains (161, or 97%) isolated from food poisoning cases were typeable. Of 146 strains isolated from 18 outbreaks, 142 (97%) could be divided into 17 phage types. A good correlation, on the order of 80 to 100%, between phage types of strains isolated from suspected foods and those of strains isolated from stools of symptomatic patients was observed. Most Bacillus thuringiensis strains were also typeable, providing further evidence of the close relatedness of B. cereus and B. thuringiensis. This phage typing scheme can be a valuable epidemiological tool in tracing the origins of food poisoning caused by B. cereus. [TOP OF PAGE]
- Recovery of somatic coliphages in shellfish. Albert, M., Vannesson, C., Schwartzbrod, L. (1995). Water Science and Technology 31:453-456. [TOP OF PAGE]
- Virological quality of the Ria de Aveiro: Validity of potential microbial indicators. Alcantara, F., Almeida, M.A. (1995). Netherlands Journal of Aquatic Ecology 29:419-425. The summer occurrence of human enteroviruses and rotaviruses in the bacteriologically clean area of the Ria de Aveiro, a coastal marine lagoon, prompted the question of the assessment of the virological quality of recreational waters and shellfish raising beds. Enteroviruses were present in surface water at a density of 3 pfu 10 l-1 and were accumulated in sediments and, especially, in cockles where they reached concentrations 2 to 3 10log units greater. Rotaviruses were detected at one 10log unit below the density of enteroviruses in sediments and cockles and were not detected in water. Four bacteriophage systems were assayed as indicators of human enteric viruses: somatic coliphages of E. coli C, sexual and sexual-RNA coliphages plated on Salmonella WG49 and phages against Bacteroides fragilis HSP40. The results obtained from 2 lagoon stations sampled in summer, autumn and winter showed that the four systems failed to indicate the presence of enteroviruses and rotaviruses in water, sediment and shellfish samples. The absence of phages of B. fragilis HSP40 in all types of samples taken from the lagoon, but not from the residual waters of the treatment station, suggests that they may suffer a strong negative pressure in this ecosystem as their proportion to the coliphages in the cockles deviated strongly from the ratio of 1:100 to 1:1000 observed at the sewage outfall. In fact, no correlation was observed between these phages and enteric viruses or coliphages. Alternatively, it is possible that the importance of diffuse faecal pollution and the interference of faecal pollutants of animal origin, including migratory sea birds which are abundant in winter, can alter the proportions of the faecal bacteriophages beyond recognition. It is apparent that bacteriophage monitoring of the health risk linked to the occurrence of viruses in the marine environment is not yet fully resolved, what may leave viral quality assessment dependent on direct detection of human enteric virus. [TOP OF PAGE]
- Suicide bombing, Bacillus style. Anonymous (1995). Discover Magazine December(December), 28-28. [TOP OF PAGE]
- Distribution comparison between coliphages and phages of anaerobic bacteria (Bacteroides fragilis) in water sources, and their reliability as fecal pollution indicators. Armon, R., Kott, Y. (1995). Water Science & Technology 31:215-222. [TOP OF PAGE]
- Electron microscopic investigation of lactic phages isolated in Turkey. Aydar, L.Y., Tunail, N. (1995). Milchwissenschaft 50:312-316. The host specifities and morphological characteristics of 24 virulent phages isolated from raw milk and wheysamples from different parts of Turkey and which affected 8 strains of Lactococcus lactis subsp. lactis, 3 of L. lactis subsp. diacetylactis, and 1 temperate phage were investigated. The temperate phage reported here is one induced from L. lactis subsp. lactis strain P131 by mitomycin C. Head structure, head dimensions, tail lengths, and tail widths of lactic phages were determined by electron microscopic analysis. The major phage groups were basically differentiated by their head structure as either prolate or isometric. Additional subgroupings were established using head dimensions or the possession of tail fibers as classification criteria. As a consequence 5 morphological groups were characterized. No relationship was found between the morphological groups and their host specifities. [TOP OF PAGE]
- Effects of basal resources, predation, and alternative prey in microcosm food chains. Balciunas, D., Lawler, S.P. (1995). Ecology 76:1327-1336. Ecological theorists propose that the species composition of trophic levels can influence the relative strengths of top-down (predation) or bottom-up (nutrient) effects in food chains. We tested this by constructing two- and three-level food chains of bacteria and protists. Bacteria made up the first trophic level. The second level contained Chilomonas paramecium alone, Colpidium cf. striatum alone, or both together. Predatory Euplotes patella occupied the third trophic level. These assemblages were cultured in microcosms containing either low- or high-nutrient medium. Manipulating nutrients and predation produced comparable changes in the abundance of bacteria. In the second trophic level, Chilomonas was usually driven extinct by predation, but Colpidium was affected more by nutrients than predation because it had a partial size refuge from predation. Both species survived more poorly with predatory Euplotes if the other was present, because the predator was more abundant and persistent when both prey were available. The predator was less persistent in high-nutrient microcosms, because additional nutrients boosted the proportion of Colpidium populations within the size refuge. This type of mechanism could limit trophic cascades in food chains where resources affect prey vulnerability. [TOP OF PAGE]
- Virus and bacteria transport in a sandy aquifer, Cape Cod, MA. Bales, R.C., Li, S., Maguire, K.M., Yahya, M.T., Gerba, C.P., Harvey, R.W. (1995). Ground Water 33:653-661. [TOP OF PAGE]
- Speculations on the influence of infecting phenotype on virulence and antibiotic susceptibility of Legionella pneumophila. Barker, J., Brown, M.R. (1995). J. Antimicrob. Chemother. 36:7-21. It is not clear how Legionella pneumophila, which is a ubiquitous aquatic organism not possessing a mammalian reservoir, evolved the ability to cause human disease. The unusual ecology of the organism may play an important role in the transmission and virulence of legionella infections. L. pneumophila can infect and kill specific species of free-living amoebae as well as multiplying as an intracellular parasite in human phagocytic cells. In nature L. pneumophila can survive and possibly replicate in free suspension, and grow in biofilms and in protozoa thus leading to diverse phenotypes, potentially with diverse virulence and susceptibility properties. Indeed, recent evidence shows that intra-amoeba growth induces a phenotype that is dramatically different physiologically to that obtained in vitro, with altered virulence and susceptibility properties. Growth in macrophages also has profound effect on the physiological properties of L. pneumophila. Many different stress proteins are expressed by the organism as a result of intra-macrophage growth. A heat shock protein is abundantly synthesised and may be presented on the surface of infected macrophages, which allows them to be targeted by T-lymphocytes for destruction. The difficulties in successfully treating Legionnaires' disease are probably influenced by the intracellular location of L. pneumophila. Retrospective clinical studies show that it is only drugs such as erythromycin, ciprofloxacin and rifampicin, which are capable of accumulating in phagocytic cells, that are efficacious in the treatment of legionnaires' disease. Despite the use of such drugs treatment failures occur, but these do not appear to be associated with the emergence of resistant strains. Studies have shown that although erythromycin and rifampicin can inhibit the multiplication of L. pneumophila in macrophages the organism is not killed and can resume multiplying when the drugs are removed. Thus a competent cell mediated immune response is important in recovery from legionella infections. There is an urgent need for greater understanding of how the changes induced by intracellular growth affect sensitivity to antibiotics and of how the changes induced by intracellular growth affect sensitivity to antibiotics and host defences. Immunocompromised patients, who have the highest mortality rates, are likely to gain the most from progress in the treatment of L. pneumophila infections. [TOP OF PAGE]
- Bor Gene of phage lambda, involved in serum resistance, encodes a widely conserved outer membrane lipoprotein. Barondess, J.J., Beckwith, J. (1995). J. Bacteriol. 177:1247-1253. bor is one of two recently identified genes of phage lambda which are expressed during lysogeny and whose products display homology to bacterial virulence proteins. bor is closely related to the iss locus of plasmid ColV,I-K94, which promotes bacterial resistance to serum complement killing in vitro and virulence in animals. bor has a similar in vitro effect. We show here that the bor gene product is a lipoprotein located in the Escherichia coli outer membrane. We also find that antigenically related proteins are expressed by lysogens of a number of other lambdoid coliphage, in cells carrying the cloned iss gene, and in several clinical isolates of E. coli. These results demonstrate that bor sequences are widespread and present a starting point for mechanistic analysis of bor-mediated serum resistance. [TOP OF PAGE]
- Biological effectiveness of environmental radiation in surface measurements by phage T7. Berces, A., Gaspar, S., Fekete, A., Kuluncsics, Z. (1995). Journal of Photochemistry and Photobiology B Biology 31:87-90. Biologically effective ultraviolet doses have been measured on summer days, at different sites of Hungary during 1994. For parallel measurements, phage T7 biological dosimeter and Robertson-Berger meters have been used. Results of cumulated daily doses and daily profiles are demonstrated for both direct and global radiation. A suggestion for the optimal number of measuring sites in a UV level forecasting system is given. [TOP OF PAGE]
- Biology of DNA restriction. Bickle, T.A., Krüger, D.H. (1995). Microbiol. Rev. 57:434-450. [TOP OF PAGE]
- Ground Water Pollution. Bitton, G., Gerba, C.P. (1995). John Wiley and Sons, New York.[TOP OF PAGE]
- High frequency of conjugation versus plasmid segregation of RP1 in epiphytic Pseudomonas syringae populations. Bjorklof, K., Suoniemi, A., Haahtela, K., Romantschuk, M. (1995). Microbiology (Reading) 141:2719-2727. The maintenance and transfer of the broad host-range plasmid RP1 in epiphytically growing populations of Pseudomonas syringae was monitored in the phyllosphere of bush bean (Phaseolus vulgaris). When foliage was inoculated with plasmid-containing bacteria, the plasmid was lost from the majority of the cells within 2 d but was stably maintained in 0.8% of the population. A high frequency of conjugation between added donors and recipients was observed under high humidity conditions. In 1 d, the number of transconjugants rose to 10-1 of the donors and the proportional level of transconjugants continued to increase until 3 d after inoculation. Under these conditions the proportion of plasmid- containing bacteria stabilized at about 0.8% of the total population. The conjugation rate appeared to be in equilibrium with plasmid loss and the slower growth of the plasmid-carrying cells. A factor that influenced the high conjugation frequency observed was the available nutrients provided by the leaf and also, to a lesser extent, the leaf surface itself. Transfer of the plasmid from added donors to indigenous bacteria was also studied, using a donor-specific bacteriophage for counterselection of the donor. Transfer was observed to 10 different species of Gram-negative epiphytically growing bacteria. The bean leaf surface appears to function as a hotspot at least for intraspecific transfer of plasmids in high humidity. The frequency of transfer was higher than in soil or in rhizosphere habitats. This is likely to be the result of an environment that is nutritionally rich in combination with a limited colonizable surface area which permits close contact between the bacterial cells. [TOP OF PAGE]
- Differential accumulation and depuration of human enteric viruses by mussels. Bosch, A., Pintó, R.M., Abad, F.X. (1995). Water Science & Technology 31:447-451. [TOP OF PAGE]
- Virusesthe new players in the game: their ecological role and could they mediate genetic exchange by transduction? Bratbak, G., Heldal, M. (1995). pp. 249-264. In AnonymousMolecular Ecology of Aquatic Microbes. Spring-Verlag KG, Berlin, Germany. [TOP OF PAGE]
- Viral activity in relation to Emiliania huxleyi bloomsa mechanism of DMSP release. Bratbak, G., Levasseur, M., Michaud, S., Cantin, G., Fernandez, E., Heimdal, B.R., Heldal, M. (1995). Mar. Ecol. Prog. Ser. 128:133-142. [TOP OF PAGE]
- Genetic conflicts and parasitism. Brookfield, J. (1995). Trends in Ecology & Evolution 10:138-139. [TOP OF PAGE]
- Effects of grazing, sedimentation, and phytoplankton cell lysis on the structure of a coastal pelagic food web. Brussaard, C.P.D., Riegman, R., Noordeloos, A.A.M., Cadee, G.C., Witte, H., Kop, A.J., Nieuwland, G., van Duyl, F.C., Bak, R.P.M. (1995). Mar. Ecol. Prog. Ser. 123:259-271. [TOP OF PAGE]
- Characterization of a temperate Streptococcus thermophilus bacteriophage and its genetic relationship with lytic phages. Brussow, H., Bruttin, A. (1995). Virology 212:632-640. The temperate Streptococcus thermophilus bacteriophage vf-SFi21 showed an 38-kb-long double-stranded DNA genome with cohesive ends. A single integration site was used in lysogens established in three different S. thermophilus strains. The attP and attB sites were localized on the restriction map of phage DNA and by hybridization on pulsed field separated bacterial DNA. All laboratory-established lysogens showed in addition to integrated prophage DNA unintegrated monomer phage DNA with unligated cos sites. The genetic relatedness of vf-SFi21 DNA with DNA from lytic phages was studied in dot blot and Southern blot hybridization by using individual restriction fragments of vf- SFi21 DNA as probes. Lytic group I phages hybridized with fragments of the central and the right part of the vf-SFi21 genome but failed to hybridize with a fragment joining both parts. Lytic group II phages showed hybridization with the right half of the vf-SFi21 genome. In lytic group IV phages, biologically a heterogeneous group, many different combinations of cross hybridization were detected in accordance with the hypothesis of the modular evolution of phage genomes. [TOP OF PAGE]
- Parasitology year 2000. Bush, A.O., Caira, J.N., Minchella, D.H., Nadler, S.A., Seed, J.R. (1995). Journal of Parasitology 81:835-842. We predict that in order for parasitology to thrive by the year 2000 the various subdisciplines of evolution, ecology, biosystematics, and genetics must develop holistic approaches and use parasite models to answer basic biological questions. The students of tomorrow must work as part of a multidisciplinary team; and their questions and answers must be conceptually integrated into the broader biological framework of evolution and ecology. [TOP OF PAGE]
- Comparative survival of hepatitis-A virus, poliovirus and indicator viruses in geographically diverse seawaters. Callahan, K.M., Taylor, D.J., Sobsey, M.D. (1995). Water Science & Technology 31:189-193. [TOP OF PAGE]
- Large Pseudomonas phages isolated from barley rhizosphere. Campbell, J.I.A., Albrechtsen, M., Sorensen, J. (1995). FEMS Microbiol. Ecol. 18:63-74. Five bacteriophages infecting common fluorescent pseudomonads (Pseudomonas fluorescens and Pseudomonas putida) were isolated from barley rhizosphere soil. Morphological and molecular characteristics of the phages are described together with selected phage-host interactions. All phages belonged to the Myoviridae family with isometrical heads on contractile tails; 4 of them were unusually large and had complex protein and DNA profiles. The large phages had estimated genome sizes of 200 kb or more. Restriction enzyme analyses and DNA-DNA hybridizations showed that all isolates represented different phage species. None of the isolates were observed to establish lysogeny with the main host strain, P. putida MM1. The large phages multiplied slowly on their hosts, producing very small plaques; one-step growth experiments with one of the large phages (Psp 4) hence demonstrated a long latent period (2.5 h) and a very small burst size (10 particles). One of the large phages (Psp 3) was abundant in the rhizosphere (approx. 10-4 pfu g-1 soil) and had a particularly broad host range which extended to both fluorescent (Pseudomonas aeruginosa, P. fluorescens, P. putida and Pseudomonas chlororaphis) and non-fluorescent (Pseudomonas stutzeri) Pseudomonas spp. occurring in soil. The ecological importance of the large Pseudomonas phages must be further studied, but their slow multiplication rates suggested a possible mechanism of balanced phage-host co-existence in the rhizosphere. [TOP OF PAGE]
- Detection of coliphages and enteroviruses in sewage and aerosol from an activated sludge wastewater treatment plant. Carducci, A., Arrighi, S., Ruschi, A. (1995). Letters in Applied Microbiology 21:207-209. Coliphages and enteroviruses were monitored over 12 months in sewage and air adjacent to an activated sludge plant. Both showed temporal variation but the mean count of phages in enterovirus-positive samples was not significantly different from that in enterovirus-negative samples. Hence coliphages are not necessarily a good indicator of enteroviruses in sewage and aerosols. [TOP OF PAGE]
- Isolation and characterization of temperature and virulent bacteriophages of Lactobacillus plantarum. Caso, J.L., De Los Reyes Gavilan, C.G., Herrero, M., Montilla, A., Rodriguez, A., Suarez, J.E. (1995). Journal of Dairy Science 78:741-750. Several bacteriophages that are able to infect Lactobacillus plantarum have been isolated by induction of lysogenic strains with mitomycin C and by enrichment of samples from different origins. Two closely related phages (PHI-LP1-A and PHI- LP1-B), isolated from corn silage, and phage PHI-LP2, isolated from a homemade cheese whey, were characterized. Some features of L. plantarum phage fri were also studied that have not been previously published. Virions of the PHI-LP1 and PHI-LP2 groups displayed a typical B1 morphology (Siphoviridae); heads were isometric, and tails were long and noncontractile. The genetic material of the virions was a single molecule of double- stranded DNA without cohesive ends. The genome lengths were 80 kbp (PHI-LP1 group), 47 kbp (PHI-LP2), and 133 kbp (fri). Host range was limited to some strains of L. plantarum. Temperature of propagation affected the appearance and aspect of the plaques of lysis. Phage adsorption was quite efficient, reaching gt 90% in most cases and often gt 99%, and was not affected by the temperature. One-step growth experiments showed that, in some cases, temperature strongly influenced the phage development. The temperate nature of the phages could only be established for phage PHI-LP2, and no lysogens were obtained for members of the PHI-LP1 group. [TOP OF PAGE]
- Links and interactions between mycoplasmas and viruses: Past confusions and present realities. Chastel, C. (1995). Archives of Virology 140:811-826. Links between mycoplasmas and viruses are ancient, multiple and complex, from past confusions during the first decades of the virus era to present realities illustrated by the possible implication of mycoplasms as co-factors in natural infections of AIDS. Mycoplasma viruses (phages) may also be responsible for modifying the pathogenic power of mycoplasmas, at least for plants and insects. In addition, several mycoplasmas are able to act as undesirable cell culture contaminants that induce erroneous results in both applied and general virology. These problems are examined within a historical context. [TOP OF PAGE]
- A role for bacteriophages in the evolution and transfer of bacterial virulence determinants. Cheetham, B.F., Katz, M.E. (1995). Molecular Microbiology 18:201-208. A virulence-associated region in the genome of Dichelobacter nodosus has been shown to contain an integrase gene which is highly related to the integrases of Shigella flexneri phage Sf6 and coliphages P4 and PHI-R73, together with open reading frames (vapB, C and D) related to genes borne on plasmids in Neisseria gonorrhoeae, Escherichia coli, Actinobacillus actinomycetemcomitans and Treponema denticola. Similar to P4 and PHI-R73, the vap region is bracketed by putative Actinobacillus bacteriophage at sites and is adjacent to a tRNA gene, which suggests that the vap region has been derived by the integration of a bacteriophage, or a plasmid carrying a bacteriophage-related integrase gene. Many similarities in genes and genes clusters encoding virulence determinants have been found in distantly related bacteria. These genes are often located on plasmids in one organism but on the chromosome in others, implying that transmission of the genes has been followed by integration. Thus, the events which have generated the vap regions of D. nodosus may represent a common mechanism for transfer of virulence determinants. A number of genes involved in the virulence of bacterial pathogens are found on integrated bacteriophages, and we suggest that others will prove to be associated with tRNA genes and/or integrase genes derived from bacteriophages. The use of tRNA genes as integration sites for many bacteriophages and plasmids may favor intergeneric transmission, as tRNA genes are highly conserved. [TOP OF PAGE]
- Nested PCR with three highly degenerate primers for amplification and identification of DNA from related organisms. Chen, F., Suttle, C.A. (1995). BioTechniques 18:609-611. This paper reports that three highly degenerate primers can be used in nested PCR, and that the second amplification can be done directly on DNA fragments excised from low melting temperature agarose. The approach provides rapid confirmation that the correct targets have been amplified. It is useful when only one internal probe sequence (or gene-specific primer) is available to confirm the identity of a PCR product, and a degenerate primer sequence must be derived from an amino acid sequence. This can occur, for example, when DNA must be amplified from a group of related organisms. [TOP OF PAGE]
- Amplification of DNA polymerase gene fragments from viruses infecting microalgae. Chen, F., Suttle, C.A. (1995). Appl. Environ. Microbiol. 61:1274-1278. Nested PCR using three highly degenerate primers was used for amplification and identification of the DNA polymerase (pol) genes from viruses which infect three genera of microalgae. Group-specific primers (AVS1, AVS2) were designed based on inferred amino acid sequences that were unique to the DNA pol genes of viruses (PBCV-1 and NY-2A) infecting an endosymbiotic Chlorella-like algae (Chlorophyceae), and a virus (MpV-SP1) which infects the photosynthetic flagellate Micromonas pusilla (Prasinophyceae). As well, a nested primer (POL) was designed based on the highly conserved amino acid sequence YGDTDS found in most B-family (*-like) DNA pol genes. These primers were used to amplify DNA from the three viruses PBCV-1, NY-2A and MpV-SP1 for which the primers were designed, as well as eight other clonal isolates of genetically distinct viruses which infect M. pusilla and viruses which infect Chrysochromulina spp., (Prymnesiophyceae) suggesting that these are a group of related viruses. The primers could also be used to amplify DNA from natural virus communities. In contrast, a product was not produced when DNA from viruses which infect the marine brown algae Ectocarpus siliculosis and Feldmannia sp. (Phaeophyceae) was used, suggesting that these viruses may not be closely related to those infecting microalgae. The primers could also be used to amplify DNA from natural virus communities. Our results indicate that nested PCR, even under low stringency conditions, can be used as a rapid method to verify the presence in seawater of a group of related viruses which infect microalgae. Sequence analysis of these fragments should provide information on the genetic diversity and possibly the phyletic relationships among these viruses. This is the first example of a PCR-based technique designed to detect viruses which infect eukaryotic algae. [TOP OF PAGE]
- Studies on diagnostic bacteriophage of Vibrio fluvialis. [Chinese]. Chen, K., Lin, Y., Chen, G. (1995). Chung-Hua Yu Fang i Hsueh Tsa Chih [Chinese Journal of Preventive Medicine] 29:138-140. Species of Vibrio fluvialis are identified by their biochemical characteristics so far, with a lot of items to be determined, overelaborate procedure and expensiveness. Inaccordance with the fact that bacteriophage is a specific parasite inhabited in bacteria and has been used in identifying other bacteria with high specificity, some of Vibrio fluvialis bacteriophage isolated from natural environment were selected to make diagnostic preparation for Vibrio fluvialis identification. Diagnostic positivity of Vibrio fluvialis averaged 84.27%, and 87.84% for those of human source. Cross-lysis rates both for the same Vibrio genus and that of different families in the same genus were less then 3%, and no cross-lysis was found for the other enteric bacteria in different genera. There was no significant difference between diagnostic bacteriophage and biochemical tests for Vibrio of unknown species. This method was highly specific, sensitive, rapid, simple and inexpensive, and could be used in diagnosis of Vibrio fluvialis. [TOP OF PAGE]
- Trypanosoma cruzi trans-sialidase: enhancement of virulence in a murine model of Chagas' disease. Chuenkova, M., Pereira, M.E. (1995). J. Exp. Med. 181:1693-1703. Trypanosoma cruzi, the etiological agent of Chagas' disease, expresses a trans-sialidase at highest levels in infective trypomastigotes, where it attaches to the plasma membrane by a glycophosphoinositol linkage. Bound enzyme sheds into the extracellular milieu in a soluble form. Experiments performed in vitro suggest that the trans-sialidase participates in several parameters of T. cruzi-host interactions, like cell adhesion and complement resistance. However, the role that membrane-bound and soluble trans-sialidase plays in the infection of mammals is not understood. To begin to study the role the enzyme may play in vivo, T. cruzi trypomastigotes were inoculated subcutaneously into mice that had been sensitized for various times with the purified protein. A single dose of either endogenous or recombinant trans-sialidase injected into the connective tissues of BALB/c mice greatly enhanced parasitemia and mortality. Maximum enhancement was achieved with 1-2-h priming. Injection of the enzyme after the parasites had been established in the inoculation site had little, if any, consequence in modifying virulence. The enhancement did not seem to be through a direct effect of the enzyme on trypomastigote-host cell interactions because it occurred when the sites of trans-sialidase sensitization and parasite inoculation were physically separate. Rather, virulence enhancement seemed to depend on inflammatory cells, since priming with trans-sialidase had no significant effect in severe combined immunodeficiency mice, which lack functional T and B lymphocytes. However, antibody response to T. cruzi in the trans-sialidase-primed BALB/c mice was the same as in the control animals. Virulence enhancement was specific for the trans-sialidase because it did not occur in mice primed with Newcastle virus sialidase, which has the same substrate specificity as the T. cruzi enzyme, or with the sialidase from the bacterium Vibrio cholerae, whose substrate specificity is broader than the trypanosome sialidase. Furthermore, no enhancement of virulence occurred after sensitization with another adhesion protein (penetrin) purified from T. cruzi trypomastigotes and engineered bacteria, nor with bacterial lipopolysaccharide. The virulence-promoting activity of soluble trans-sialidase in the mouse model may be physiologically relevant because it was achieved with tiny doses, approximately 1-2 microgram/kg, raising the possibility that neutralization of the enzyme with specific probes could impair the development of Chagas' disease. In fact, a monoclonal antibody specific for the tandem repeat in the trans-sialidase COOH terminus enhanced infection of BALB/c mice, in agreement with earlier experiments in vitro, whereas antibodies against an amino acid sequence in the Cys region had the opposite effect. [TOP OF PAGE]
- Lysotypie des Acinetobacter. Coffi, H. (1995). Laval University, Quebec, Canada. [TOP OF PAGE]
- Bacteriophages in mussels and in waters for the cultivation of molluscs [Batteriofagi nei mitili e in acque per la molluschicoltura]. Contato, E., Mirolo, G., Sartea, A., Tampieri, M.L., Tuffanelli, A., Chiccoli, M., Bucci, G. (1995). Igiene Moderna [IG. MOD. ] 103:361-371. For some time now, coliphages have been proposed as enterovirus detectors in water owing to their resistance to chlorination and environmental stress and to their morphologic and biochemical characteristics which are similar to those of the enteroviruses. In this study, we have compared data regarding the analysis of 157 samples of water for the production of molluscs and 157 samples of mussels (Mytilus galloprovincialis) cultivated in these waters. Both in the samples of water and in the mussels we looked for the presence of E. coli, Salmonella and E. coli bacteriophages. Furthermore, in 148 samples of mussels, we looked for the presence of fecal coliforms. The search for bacteriophages was carried out with the "plaque count in agar" method. None of the samples showed the presence of Salmonella. Comparison of the data shows that there is no correlation between bacterial organisms and phages. The average monthly trend values of E. coli and phages present in mussels and water show a substantial increment during autumn and winter. [TOP OF PAGE]
- Viruses and the Environment. Cooper, J.I. (1995). Chapman and Hall, London.During the decade since the publication of the first edition of this important book there has been a rapid advancement in the techniques of genetic engineering and molecular biology. In this revised edition these advances are taken into account and the book includes such topics as gene therapy, immunosuppression and new viruses of human/veterinary significance. Much new information about virus transmission is also included and the most modern systems of virus taxonomy are used to emphasize the features shared between viruses in plants, animals, and bacteria. This is the only book of its type which covers the viruses in all forms of life. This book is of value to students and professsional from fields as diverse as molecular biology and microbiology to environmental and agricultural science. [phage ecologists may be particularly interested in chapter 6 titled, "Strategies of virus maintenance in communities" - STA]. [TOP OF PAGE]
- Genetic diversity of algal viruses which lyse the photosynthetic picoflagellate Micromonas pusilla (Prasinophyceae). Cottrell, M.T., Suttle, C.A. (1995). Appl. Environ. Microbiol. 61:3088-3091. The genetic similarity among eight clones of Micromonas pusilla virus (MpV) isolated from five geographic locations was measured by DNA hybridization. Our objective was to explore the existence of genetically distinct populations of MpV by comparing the similarity among MpVs isolated from a single water sample to the similarity among viruses isolated from geographically distant locations. The highest and lowest similarities we observed were 70% plus or minus 1.1% (mean plus or minus standard error [SE], n = 3) for virus strains SP1 and SP2 isolated from a California coastal water sample and 13% plus or minus 1.9% for strains SP2 and PB6; the latter was isolated from New York estuarine water. However, the similarity between MpV isolated from a single water sample was not always greater than the similarity between viruses isolated from different locations. Viruses PB7 and PB8 were isolated from a single New York estuarine sample but were only 16% plus or minus 0.5% similar, whereas PB7 was quite similar (43% plus or minus 2.9%) to PL1, a virus from Texas coastal water. Overall, the similarity among MpVs isolated from a single geographic location, 34% plus or minus 12.6% (mean plus or minus SE, n = 4), was not significantly different from the similarity among MpVs isolated from geographically distant locations, 26.6% plus or minus 2.7% (mean plus or minus SE, n = 24) (P = 0.92, Mann-Whitney U test). Clones of MpV were more similar to each other than they were to the related algal virus PBCV-1, and three groups of MpVs consisting of (i) PL1, SG1, PB6, and PB7, (ii) PB8, and (iii) GM1, SP1, and SP2 were resolved. The genetic variation among MpVs isolated from a single water sample was as large as the variation between viruses isolated from different oceans. If MpVs within a geographic location share genetic characteristics not shared with MpVs from geographically distant locations, this was not reflected in the overall similarity of their genomes. [TOP OF PAGE]
- Dynamics of a lytic virus infecting the photosynthetic marine picoflagellate Micromonas pusilla. Cottrell, M.T., Suttle, C.A. (1995). Limnol. Oceanogr. 40:730-739. The impact of Micromonas pusilla virus (MpV) on Micromonas pusilla was inferred from measurements of the abundance of MpV, the kinetics of MpV adsorption to host cells, and the estimated in situ decay rate of MpV infectivity. The viral production rate was calculated to balance the estimated in situ decay rate of MpV infectivity. In inshore water of the Texas coast, the abundance of infective MpV was high and decreased from 130,000/ml in January 1993 to 2100/ml, at the end of April 1993. Decay rates of MpV infectivity in seawater incubated in the dark ranged from 0.06/d at 4 degree C to 0.09/d at 25 degree C. In unattenuated sunlight, decay rates of infectivity were much higher, ranging from 6.9 to 7.1/d. Sunlight-mediated decay rate of viral infectivity was depths-dependent, with an attenuation coefficient estimated to equal 0.73/m. The MpV production rate was 0.79/d, equal to a turnover time of 1.3 d. MpV abundance changed slowly relative to its turnover time, suggesting a stable coexistence of M. pusilla and the lytic virus. The adsorption coefficient for MpV-SP1 and host strain Plymouth 27 was 1.40 x 10-9 ml/min. Using this coefficient, we calculated that from 2 to 10% of the M. pusilla population was lysed per day (avg, 4.4%/d). These results suggest that lysis of phytoplankton by viruses is a process that needs to be incorporated into models of nutrient and energy cycling in aquatic food webs. [TOP OF PAGE]
- Cell surface differences in lactococcal strains. Crow, V.L., Gopal, P.K., Wicken, A.J. (1995). International Dairy Journal 5:45-68. A number of cell surface properties were compared in 15 pairs of lactococcal strains in order to gain an understanding of cell surface diversity and the relationship between the acquisition of the phage-resistance phenotype and alteration of cell surface properties. Each pair comprised a parent strain and a derivative resistant to a phage (PHI-R) or a number of phages. Three cell surface hydrophobicity patterns were found: (1) three parent strains were more hydrophobic than their O-R derivatives; (2) five PHI-R derivatives were more hydrophobic than their parent strains; (3) there were no differences for seven strain pairs. Loosely associated cell surface material was removed without cell lysis, and concentration differences between 28 strains of 40-, 23- and 11-fold were found for the extracted protein, hexose and thamnose, respectively. These three surface components were extracted in higher concentrations from the PHI-R derivative for seven strain pairs and from the parent strain for three strain pairs, and no differences were observed for four strain pairs. Intracellular and extracellular lipoteichoic acid concentrations varied in four of six strain pairs studied. The extracted protein profiles determined on polyacrylamide gels and by Superose 12 chromatography and the compositions of the extracted polysaccharide were different between most of the strain pairs. In addition, the surface properties, particularly cell hydrophobicity, varied according to growth conditions for some strains. The cell-surface components showed considerable diversity within the 30 lactococcal strains studied, with multiple differences between many of the strain pairs. For example, differences in hydrophobicity, the extracellular lipoteichoic acid concentration, molecular weight profile of proteins and the amount of protein, hexose and rhamnose extracted as loosely associated cell surface material were observed between the strains of pair E8/398. No unifying theme was evident to describe the basis of changes to the cell surface in the phage-resistant derivative strains. [TOP OF PAGE]
- The influence of phage-assisted Lysis of Lactococcus lactis subsp. lactis ML8 on cheddar cheese ripening. Crow, V.L., Martley, F.G., Coolbear, T., Roundhill, S.J. (1995). International Dairy Journal 5:451-472. Cheddar cheese was made with Lactococcus lactis subsp. lactis strain ML8 as starter and two levels of rennet and three levels of homologous phage. The use of the different phage levels in cheese milk resulted in various degrees of starter lysis early in the ripening process. The levels of activity of two starter cytoplasmic enzymes, lysylaminopeptidase and FBP-aldolase, in the cheese matrix were used as a direct measure of lysis and increased with the level of phage added. Elevated starter lysis was associated with an increased rate of formation of amino acids and ammonia but the removal rate of lactose in the cheese was decreased. The relative levels of hydrophobic and hydrophilic peptides in aqueous cheese extracts were also influenced by the extent of starter lysis. Bitter flavour was prominent in cheese with high rennet concentration, but not when there was also high starter lysis. The results suggest that a balance of lysed and intact cells is important for control of cheese ripening; enzymes released on cell lysis accelerate the rate-limiting peptidolytic steps and removal of some bitter peptides, while intact cells are required for lactose removal. The consequences of the relative levels of intact and lysed cells on substrate-enzyme interactions, enzyme stability and flavour profiles are discussed. [TOP OF PAGE]
- Incidence of lysogeny in wild lactococcal strains. Cuesta, P., Suarez, J.E., Rodriguez, A. (1995). Journal of Dairy Science 78:998-1003. The incidence of lysogeny among 172 lactococcal strains, isolated from natural dairy fermentations and selected by their high capacity to coagulate milk and to produce lactic acid, was studied. Lysis of 92 strains (53% of the strains tested) was observed after using mitomycin C for induction of cultures. Fifty- one of these 92 strains released phages that were able to propagate on indicator strains. Twenty-eight (16%) of the 172 strains tested acted as host for at least one phage, although some supported the development of more than one phage isolate. Spontaneous induction was insignificant in gt 50% of strains inducible by mitomycin C, but titers after mitomycin C induction varied between 10-1 and 10-6 pfu/ml. No plaque formation was observed at 37 degree C. The bacteriophages belonged to the family Siphoviridae, as revealed by electron microscopy. Head and tail dimensions ranged widely. Some temperate phages that were unable to form plaques of lysis appeared to be defective viral particles. [TOP OF PAGE]
- Characterisation of four Leuconostoc bacteriophages isolated from dairy fermentations. Davey, G.P., Ward, L.J.H., Brown, J.C.S. (1995). FEMS Microbiol. Let. 128:21-26. Four bacteriophages (phages) growing on the same Leuconostoc strain were characterized. Electron micrographs showed these phages to be similar in morphology to the commonly isolated lactococcal phages with head diameters ranging from 49-55 nm and tail lengths of 117-131 nm. A distinctive base plate and collar were also present. From restriction enzyme analysis of purified phage DNA, the genome sizes were 23-29 kb. All four phages showed one major structural protein (of approximately 24 kDa) on SDS polyacrylamide gels. Hybridization experiments confirmed that the phages belonged to the same homology group. There was no homology between DNA from these phages and DNA from a prolate or small isometric lactococcal phage. [TOP OF PAGE]
- Developing new starters for fermented milk products. Davidson, B.E., Hillier, A.J. (1995). Australian Journal of Dairy Technology 50:6-9. The production of fermented milk products has evolved from a cottage industry to a large scale, factory-based manufacturing process within a century. One consequence of this rapid evolution of technology has been that the demand for suitable starter strains has become more stringent. A satisfactory dairy fermentation requires a stable, predictable rate of acid production. Phage infection must not be allowed to interfere with this. Ultimately the fermented product must develop a desirable, long-lasting flavour - preferably after spending the minimum time in storage. The development of successful starter strategies to meet these requirements has involved the application of established bacteriological techniques with particular care being devoted to strain characterisation. Detailed analyses of the molecular genetics of different lactic acid bacteria has been feasible for little more than a decade, but the tempo of discovery has increased dramatically throughout this period. For Lactococcus lactis, which is a commonly used starter for cheese manufacture, the situation now exists where there are excellent prospects for directed molecular approaches to strain improvement. Thus, with the aid of biotechnology it should be possible to identify and/or construct starter strains that have: good flavour-producing characteristics, satisfactory rates of acid production and improved phage resistance properties. [TOP OF PAGE]
- Spatial and temporal distribution of fecal coliforms, coliphages, moulds and yeasts in freshwater at the semi-arid tropic northeast region in Brazil (Paraiba State). De Ceballos, B.S.O., De Lima, E.O., Koenig, A., Martins, M.T. (1995). Revista de Microbiologia 26:90-100. The distribution of fecal coliforms, coliphages, moulds and yeasts was evaluated during the dry (summer) and rainy (winter) seasons in three lakes and two streams presenting different levels of fecal pollution, located in a semi-arid region of the Northeast of Brazil (Paraiba state). Boqueirao lake waters were found to be suitable for bathing but not for unrestricted irrigation. Rain contributed to fecal pollution to a large extent. Fungal diversity in the lakes increased in parallel with fecal contamination. Moulds were present in all the samples but yeasts were consistently present in the high fecal pollution environments (chi-2o = 69; chi-2cr = 9.21; alpha=0.01), where Candida exhibited the highest diversity (7 species). The incidence of NSF, Candida spp. and C. albicans was higher in the more polluted waters, showing statistically significant differences (NSF-chi-2o = 26.2; Candida spp. chi-2o = 12.96; chi-2cr = 9.21; alpha = 0.01). Both streams did not present any significant differences in the number of taxa and fecal concentrations. However, the incidence of NSF and C. albicans was associated with fecal coliform levels. The results suggested that NSF, Candida spp. and C. albicans are potential indicators of fecal contamination in tropical semi-arid freshwaters. Regional studies on substrate diversity could lead to a better understanding of the distribution and richness of geofungi. [TOP OF PAGE]
- Relationships among Actinomyces naeslundii (A. viscosus) bacteriophages isolated from sewage and the oral cavity. Delisle, A.L., Donkersloot, J.A. (1995). Microbial Ecology in Health & Disease 8:121-127. Several lytic phages of Actinomyces naeslundii genospecies 2 (formerly A. viscosus) have been isolated from sewage and from dental plaque. To define the relationships between these phages and ultimately to assess their role in the ecology of the human oral cavity, 13 phages isolated from these two environments were purified and their biochemical properties compared. Five small, short-tailed phages, isolated from sewage over the course of several years (Av-1, Av-2, Av-3, 1281, and BF307) were morphologically indistinguishable from each other and from five phages recovered more recently from human dental plaque (CT1, CT2, CT3, CT6 and CT7). The small phages (all morphotype C1) contained double-stranded linear DNA, 18 kb in size. In contrast, three phages from dental plaque (CT4, CT5 and CT8) possessed longer tails and much larger head structures (morphotype B1). Two of the larger phages (CT4 and CT5) contained DNA genomes estimated to be 80 kb in size, whereas large phage CT8 contained DNA of approximately 50 kb. Restriction endonuclease analysis revealed extensive differences between the large and small phages but the latter group showed similar, and in several cases identical, fragment patterns. These results indicate the existence of at least three distinct types of lytic bacteriophage active against oral Actinomyces spp. The similarities between the sewage and small dental plaque isolates indicate a high degree of relatedness and suggest that the sewage phages probably originated from the oral cavity. [TOP OF PAGE]
- Phylogeny of Aureococcus anophagefferens and a morphologically similar bloom-forming alga from Texas as determined by 18S rDNA sequence analsysis. DeYoe, H.R., Chan, A.M., Suttle, C.A. (1995). Journal of Phycology 31:413-418. [TOP OF PAGE]
- Bacteriophage resistance in Lactococcus. Dinsmore, P.K., Klenhammer, T.R. (1995). Molecular Biotechnology 4:297-314. Lactic acid bacteria are industrial microorganisms used in many food fermentations. Lactococcus species are susceptible to bacteriophage infections that may result in slowed or failed fermentations. A substantial amount of research has focused on characterizing natural mechanisms by which bacterial cells defend themselves against phage. Numerous natural phage defense mechanisms have been identified and studied, and recent efforts have improved phage resistance by using molecular techniques. The study of how phages overcome these resistance mechanisms is also an important objective. New strategies to minimize the presence, virulence, and evolution of phage are being developed and are likely to be applied industrially. [TOP OF PAGE]
- Neutralizing recombinant human antibodies to a conformational V2- and CD4-binding site-sensitive epitope of HIV-1 gp120 isolated by using an epitope-masking procedure. Ditzel, H.J., Binley, J.M., Moore, J.P., Sodroski, J., Sullivan, N., Sawyer, L.S., Hendry, R.M., Yang, W.P., Barbas, C.F., Burton, D.R. (1995). Journal of Immunology 154:893-906. As part of the goal of assembling a mixture of neutralizing human mAbs for possible prophylaxis and therapy of HIV-1 disease, we describe a strategy by which neutralizing human Abs to a weakly immunogenic epitope can be accessed. From a phage display library derived from an asymptomatic HIV-1 seropositive donor, a panel of recombinant Fabs against the CD4 binding site (CD4bs) of gp120 was retrieved by affinity selection using recombinant gp120 (strain LAI). Two Fabs corresponding to the dominant clones were used to mask the CD4bs epitope(s) before repeating the selection procedure. Four Fabs were then retrieved that had novel heavy chain sequences. Three recognized a novel epitope distinct from that recognized by conventional CD4bs Abs and were defined by the following criteria: 1) second V region (V2 region) dependence indicated by sensitivity to amino acid changes in the V2 loop and by competition with murine anti-V2 mAbs; 2) CD4bs dependence indicated by sensitivity to amino acid changes usually associated with CD4 binding and by inhibition of Fab binding to gp120 by soluble CD4; this dependence seemed to arise via conformational changes rather than by direct binding, as CD4bs Abs enhanced binding of two of the novel Fabs and, in a reversal of the competition format, the novel Fabs did not inhibit soluble CD4 binding to gp120; and 3) equivalent binding to glycosylated and deglycosylated gp120 and significant, although much reduced, binding to denatured gp120 in contrast with CD4bs Abs, which do not bind to deglycosylated or denatured gp120. One of the novel Fabs efficiently neutralized the MN and LAI strains of HIV-1. These results indicate the presence of a novel neutralizing conformational epitope on gp120 sensitive to the V2 loop and the CD4bs and further highlight the conformational flexibility of gp120. The strategy of masking highly immunogenic epitopes with Abs to rescue a broader range of specific Abs from combinatorial libraries should be widely applicable. [TOP OF PAGE]
- Somatic and F-specific coliphages in New Zealand waste treatment lagoons. Donnison, A.M., Ross, C.M. (1995). Water Res. 29:1105-1110. Three coliphages (FRNA, FDNA and somatic) and three bacteria) indicators (faecal coliforms, Escherichia coli and enterococci) were measured in four waste-treatment lagoons over 10 months. Two of the lagoons treated domestic sewage; the third, meat processing waste and the fourth, meat processing waste with a minor sewage component. In the meat processing lagoons the ratios of FRNA:FDNA were numerically large, due to very low counts of FDNA, and somatic coliphages generally outnumbered FRNA. Many of the FDNA plaques from meat processing lagoons were very small and were not confirmed on the F-plus strain, E. coli C 3000. In sewage lagoons all three coliphages were consistently present and FRNA usually outnumbered both FDNA and somatic coliphages. However, the ratios of FRNA to the other two coliphages were not numerically large. Ratios of coliphages, especially of FRNA: FDNA, seem a promising toot to distinguish between human and animal faecal pollution. Overall, there were no strong correlations between the bacterial indicators and the coliphages. [TOP OF PAGE]
- Lytic infection of Escherichia coli biofilms by bacteriophage T4. Doolittle, M.M., Cooney, J.J., Caldwell, D.E. (1995). Canadian Journal of Microbiology 41:12-18. Escherichia coli 3000 XIII formed biofilms on the surface of polyvinylchloride coupons in a modified Robbins device. Bacteriophage T4D+ infected cells in the biofilm and replicated. It is commonly held that bacteriophage cannot infect surface- attached bacteria (biofilms) because such bacteria are protected by an exopolymeric matrix that binds macromolecules and prevents their diffusion into the biofilm. To our knowledge this is the first observation that a bacteriophage can infect and multiply within cells growing as a biofilm. [TOP OF PAGE]
- Behavior of Escherichia coli and male-specific bacteriophage in environmentally contaminated bivalve molluscs before and after depuration. Dore, W.J., Lees, D.N. (1995). Appl. Environ. Microbiol. 61:2830-2834. We monitored the differential reduction rates and elimination patterns of Escherichia coli and male-specific (F+) bacteriophage during UV depuration for 48 h in oysters (Crassostrea gigas) and mussels (Mytilus edulis) contaminated by short-term (1 to 3 weeks) and long-term (more than 6 months) exposure to sewage in the marine environment. The time taken to reduce levels of E. coli by 90% was 6.5 h or less in all cases. In contrast, the amounts of time needed to reduce levels of F+ bacteriophage by 90% were considerably longer: 47.3 and 41.3 h (after short- and long-term exposures, respectively) in mussels and 54.6 and 60.8 h (after short- and long-term exposures, respectively) in oysters. No differences in the rates of reduction of indicators of viral pollution following exposure of the shellfish to either short- or long-term sewage contamination were observed. Further experiments were conducted with mussels to determine the relative distributions of E. coli and F+ bacteriophage in tissue before and during depuration. Prior to depuration the majority of E. coli organisms (90.1%) and F+ bacteriophage (87.3%) were detected in the digestive tract (i.e., the digestive gland and intestine). E. coli and F+ bacteriophage were reduced in all tissues except the digestive gland to undetectable levels following depuration for 48 h. Within the digestive gland, levels of F+ bacteriophage were reduced to 30% of initial levels, whereas E. coli was reduced to undetectable levels. These results confirm previous laboratory studies showing the differential reductions of levels of E. coli and F+ bacteriophage during depuration. They also demonstrate that these differential elimination patterns are not affected by the duration of sewage contamination and that F+ bacteriophage are retained only in the digestive gland and are not sequestered into other internal tissues. [TOP OF PAGE]
- A Starter Culture Rotation Strategy Incorporating Paired Restriction/Modification and Abortive Infection Bacteriophage Defenses in a Single Lactococcus lactis Strain. Durmaz, E., Klaenhammer, T.R. (1995). Appl. Environ. Microbiol. 61:1266-1273. Three derivatives of Lactococcus lactis subsp. lactis NCK203, each with a different pair of restriction/modification (R/M) and abortive infection (Abi) phage defense systems, were constructed and then rotated in repeated cycles of a milk starter culture activity test (SAT). The rotation proceeded successfully through nine successive SATs in the presence of phage and whey containing phage from previous cycles. Lactococcus cultures were challenged with 2 small isometric-headed phages, vphi-31 and ul36, in one rotation series and with a composite of 10 industrial phages in another series. Two native lactococcal R+/M+ plasmids, pTRK68 and pTRK11, and one recombinant plasmid, pTRK308, harboring a third distinct R/M system were incorporated into three NCK203 derivatives constructed separately for the rotation. The R+/M+ NCK203 derivatives were transformed with high-copy-number plasmids encoding four Abi genes, abiA, abiC, per31, and per50. Various Abi and R/M combinations constructed in NCK203 were evaluated for their effects on cell growth, level of phage resistance, and retardation of phage development during repeated cycles of the SAT. The three NCK203 derivatives chosen for use in the SAT exhibited additive effects of the R/M and Abi phenotypes against sensitive phages. In such combinations, phage escaping restriction are prevented from completing their infective cycle by an abortive response that kills the host cell. The rotation series successfully controlled modified, recombinant, and mutant phages which were resistant to any one of the individual defense systems by presenting a different set of R/M and Abi defenses in the next test of the rotation. [TOP OF PAGE]
- Bacteriophages of Erwinia carotovora and Erwinia ananas isolated from freshwater lakes. Eayre, C.G., Bartz, J.A., Concelmo, D.E. (1995). Plant Disease 79:801-804. Bacteriophages for Erwinia carotovora subsp. carotovora and for E. ananas were readily isolated from freshwater lakes in Florida and Texas. Approximately 15% of enrichment cultures with 48 strains of E. carotovora yielded phage. Nineteen of 22 phages had distinct host ranges among the 62 strains and up to 10 strains were susceptible to a single phage. Among strains representing 24 serotypes, 12 of 15 phages caused plaques in lawns of 16 serotypes. Each of 13 enrichment cultures with strains of E. ananas yielded at least one phage and five distinct host range patterns emerged among host strains and phage isolates. The number of susceptible hosts for each phage ranged from one to six. [TOP OF PAGE]
- Nodulation of Vicia faba plants by Rhizobium leguminosarum biovar Viciae raised in modified tube culture containing active transducing phages. El-Didamony, G. (1995). Egyptian Journal of Botany 35:163-176. Rhizobium leguminosarum biovar Viciae s (local strain) successfully formed nodules with Vicia faba plants which were raised in modified tube culture containing active phages. Susceptibility test indicated that, some of the isolated rhizobia from these nodules were phage-resistant, while the others were still sensitive Lysogenic strain formed by phage RLZ13 was able to form nodules containing rhizobia resistant to all tested phages.Some of these phages were also able to transduce the antibiotic marker from mutant local strain (str+ & nif+) to wild one (str- & nif-). [TOP OF PAGE]
- Partial characterization of Streptomyces phages isolated from the soils of jarrah forest in Western Australia. El-Tarabily, K.A., Kurtboke, D.I., Hardy, G.E.S. (1995). Actinomycetes 6:7-15. [TOP OF PAGE]
- Evolution: A composite model. Emiliani, C. (1995). Evolutionary? Therory 10:299-303. [TOP OF PAGE]
- Detection of F+ bacteriophage in large volumes of water by a membrane filter method (MFM). Erb, P., Nasser, A.M., Fattal, B. (1995). Water Science and Technology 31:211-214. [TOP OF PAGE]
- The evolution of virulence: A unifying link between parasitology and ecology. Ewald, P.W. (1995). Journal of Parasitology 81:659-669. [TOP OF PAGE]
- Can phage defence maintain colicin plasmids in Escherichia coli? Feldgarden, M., Golden, S., Wilson, H., Riley, M.A. (1995). Microbiology 141:2977-2984. We examined the role of plasmid-based phage defence in maintaining plasmids, using colicin plasmids in Escherichia coli as a model system. Experimental data indicated that the possession of a colicin plasmid can confer limited protection against bacteriophages. A continuous culture model, using these experimental values, indicated that the observed limited protection alone could selectively maintain colicin plasmids, without requiring a competitive advantage due to colicinogeny. Phage defence might explain the current maintenance of colicin plasmids, given the naturally occurring high levels of resistance to colicins. This model also suggests that many plasmids might be maintained in natural populations, in part, by phage resistance, including 'cryptic' plasmids for which no phenotype is known. [TOP OF PAGE]
- Bacteriophage resistance in Lactococcus: characterization of the ScrFI restriction/modification system from Lactococcus lactis subsp. cremoris UC503. Fitzgerald, G.F., Twomey, D.P., Daly, C., Coffey, A. (1995). pp. 581-590. In In Ferretti, J., Gilmore, M., Klaenhammer, T., and Brown, F. (eds.), Genetics of streptococci, enterococci and lactococci. Karger, Basel. [TOP OF PAGE]
- Phage infection, transfection and transformation of Mycobacterium avium complex and Mycobacterium paratuberculosis. Foley-Thomas, E.M., Whipple, D.L., Bermudez, L.E., Barletta, R.G. (1995). Microbiology 141 ( Pt 5):1173-1181. Mycobacterium avium complex strains and Mycobacterium paratuberculosis are closely related intracellular pathogens affecting humans and animals. M. avium complex infections are a leading cause of morbidity and mortality in AIDS patients, and M. paratuberculosis is the agent of Johne's disease in ruminants. Genetic manipulation of these micro-organisms would facilitate the understanding of their pathogenesis, the construction of attenuated vaccine strains and the development of new drugs and treatment methods. This paper describes the replication of mycobacterial shuttle phasmids and plasmids, and the expression of the firefly luciferase reporter gene in M. avium complex and M. paratuberculosis. The mycobacteriophage TM4 propagated on M. smegmatis or M. paratuberculosis plaqued at the same efficiency on these two mycobacterial hosts. Screening of M. avium complex and M. paratuberculosis clinical isolates with TM4-derived luciferase reporter phages demonstrated that the majority of these isolates were susceptible to TM4. Conditions for introduction of DNA were determined by transfection of M. paratuberculosis with TM4 DNA and applied to isolate kanamycin-resistant transformants of M. avium complex and M. paratuberculosis with Escherichia coli-Mycobacterium shuttle plasmids. Recombinant plasmids were recovered from transformants without apparent loss of DNA sequences. These results provide the basis for the genetic manipulation of these pathogenic mycobacterial species. [TOP OF PAGE]
- Evaluation of Serratia marcescens bacteriophage as a tracer and a model for virus removal in waste stabilisation ponds. Frederick, G.L., Lloyd, B.J. (1995). Water Science and Technology 31:291-302. [TOP OF PAGE]
- Viruses and protists cause similar bacterial mortality in coastal seawater. Fuhrman, J.A., Noble, R.T. (1995). Limnol. Oceanogr. 40:1236-1242. Mesocosms filled with 80 liters of coastal seawater from Santa Monica, California, were used twice (June and November) to budget bacterial production and loss, as well as to assess the relative significance of viral lysis and protist grazing in bacterial mortality. Bacterial abundance was apprx 6 times 10-9 cells liter-1 in June and 2 times 10-9 in November, with viral abundances apprx 2 times 10-10 particles liter-1 in June and 1.5 times 10-10 in November. Incorporation of (3H)thymidine and leucine yielded essentially identical production estimates and allowed calculation of total bacterial mortality in these closed systems. Bacterial growth rates were 1-2 d-1 in June and 1-3 d-1 in November. Three independent lines of evidence indicated that bacterial mortality attributed to grazing by protists was about equal to that attributed to viruses: size fractionation of disappearance of labeled DNA, with a 50% reduction after protists were removed; comparison of protist grazing rates estimated with fluorescently labeled bacteria and virus production-based bacterial lysis rates, with 40-50% of the total ascribed to viruses; and model-based interpretation of the 3.3-4.6% of bacteria visibly infected with assembled intracellular viruses, suggesting that 24-66% of loss is due to infection. Redundant production and loss measurements as well as the independent loss process estimates agreed within apprx 30%, yielding a reasonably balanced budget. We believe the loss of bacteria to viruses reflects a significant dissipation of energy in this ecosystem and that viruses and protists contribute similarly to bacterial mortality. [TOP OF PAGE]
- Phagotherapy of nosocomial strains of P. aeruginosa, belonging to the o-groups. Gabisonia, T.G., others??? (1995). Georg. Med. News. (I suspect this is "Georgia Medical News" and I also suspect this is Georgia as in the former USSR) N.15:19-21. [TOP OF PAGE]
- The Revenge of the Germs, or Just Keep Inventing New Drugs. Garrett, L. (1995). p. ???-??? AnonymousThe Coming Plague: Newly Emerging Diseases in a World Out of Balance. ???, ??? [TOP OF PAGE]
- Cloning and DNA sequence analysis of two abortive infection phage resistance determinants from the lactococcal plasmid pNP40. Garvey, P., Fitzgerald, G.F., Hill, C. (1995). Appl. Environ. Microbiol. 61:4321-4328. The lactococcal plasmid pNP40, from Lactococcus lactis subsp. lactis biovar diacetylactis DRC3, confers complete resistance to the prolate-headed phage vphi-c2 and the small isometric-headed phage vphi-712 in L. lactis subsp. lactis MG1614. A 6.0-kb NcoI fragment of pNP40 cloned in the lactococcal Escherichia coli shuttle vector pAM401 was found to confer partial resistance to vphi-712. Subcloning and deletion analysis of the recombinant plasmid pPGO1 defined a 2.5-kb ScaIHpaI fragment as conferring phage insensitivity. Sequence analysis of this region confirmed the presence of two overlapping open reading frames (ORFs). Further subcloning of pNP40 to characterize the resistance determinant active against vphi-c2 identified a 5.6-kb EcoRV fragment of pNP40 which, when cloned in pAM401, conferred partial resistance to both vphi-c2 and vphi-712. Subcloning and deletion analysis of the recombinant plasmid pCG1 defined a 3.7-kb EcoRV-XbaI fragment as encoding phage insensitivity. DNA sequence analysis of this region revealed the presence of a single complete ORF. The introduction of a frameshift mutation at the unique BglII site within this ORF disrupted the phage resistance phenotype, confirming that this ORF is responsible for the observed phage insensitivity. The mechanisms encoded by pPGOI and pCGI in L. lactis subsp. lactis MG1614 conformed to the criteria defining abortive infection and were designated AbiE and AbiF, respectively. Analysis of the phage DNA content of vphi-712-infected hosts containing AbiF demonstrated that it inhibited the rate of phage DNA replication, while AbiE had little effect on phage DNA replication, suggesting a later target of inhibition. The predicted protein product of abiF shows significant homology to the products of two other lactococcal abortive infection genes, abiD and abiD1. [TOP OF PAGE]
- Molecular genetics of bacteriophage and natural phage defence systems in the genus Lactococcus. Garvey, P., van Sinderen, D., Twomey, D.P., Hill, C., Fitzgerald, G.F. (1995). International Dairy Journal 5:905-947. Bacteriophage infection of starter cultures used in a range of milk fermentation processes, particularly those involving Lactococcus lactis, poses a significant problem in industrial practice. The application of genetic and molecular technologies to the study of lactococcal bacteriophages has proven to be very rewarding in terms of understanding the nature of phage with respect to their physical and genetic organisation. The availability of the full genomic sequence of a number of phages provides an unambiguous basis for determining the relationship between them, for elucidating their evolutionary progression and will also yield strategies for obstructing successful phage proliferation on previously sensitive hosts. The genetic analysis of phage/host interactions has also highlighted the presence of natural defence systems (e.g. adsorption blocking, inhibition of phage DNA entry, restriction modification and abortive injection) in lactococci. A number of restriction modification systems and abortive infection mechanisms have been characterized at a molecular level and the genes involved have been cloned and sequenced. Plasmid-encoded phage resistance mechanisms can be exploited to generate strains which can successfully counter phage proliferation and will provide a basis for understanding the complex interactions between phages and their target hosts at a molecular level. [TOP OF PAGE]
- Large double-stranded DNA viruses which cause the lysis of marine heterotrophic nanoflagellates (Bodo sp.) occur in natural marine virus communities. Garza, D.R., Suttle, C.A. (1995). Aquat. Microb. Ecol. 9:203-210. A virus (BV-PW1) which causes lysis of two strains of a marine heterotrophic nanoflagellate belonging to the genus Bodo (strains E1 and E4) was isolated from the coastal waters of Texas. Transmission electron microscopy of ultrathin sections revealed the presence of intracellular virus-like particles 48 h following infection, concomitant with a decline in flagellate numbers. The virus contains double-stranded DNA, is hexagonal in cross-section, ca. 230-300 nm in diameter and contains an electron dense core. It is morphologically similar to virus-like particles which have been observed in other heterotrophic nanoflagellates, and to viruses which have been isolated which infect eukaryotic phytoplankton. Addition of the viruses to cultures of Pseudobodo parvulus (ATCC 50091, formerly Bodo parvulus) or Paraphysomonas imperforata (strain VS1) did not result in lysis. To our knowledge this is the first virus infecting heterotrophic nanoflagellates which has been isolated and maintained in culture. The presence of viruses in seawater which cause lysis of phagotrophic nanoflagellates implies that viruses infect microzooplankton populations in the sea and suggests another important role for viruses in aquatic microbial communities. [TOP OF PAGE]
- Occurrence of Propionibacterium freudenreichii bacteriophages in swiss cheese. Gautier, M., Rouault, A., Sommer, P., Briandet, R. (1995). Appl. Environ. Microbiol. 61:2572-2576. We isolated bacteriophages active against Propionibacterium freudenreichii from 16 of 32 swiss cheese samples. Bacteriophage concentrations ranged from 14 to 7 x 10(5) PFU/g, depending on the sample and the sensitive strain used for detection. Only a few strains, 8 of the 44 strains of P. freudenreichii in our collection, were sensitive. We observed that multiplication of bacteriophages occurred in the cheese loaf during multiplication of propionibacteria in a warm curing room, but it seems that these bacteriophages have no adverse effect on the development of the propionic flora. We also found that sensitive cells, originating from either the starter or the cheese-making milk, were present at a high level (10(9) CFU/g) in the cheese. [TOP OF PAGE]
- Mutual adaptation of bacteriophage fd, pfd plasmids and their host strains. Geider, K., Baldes, R., Bellemann, P., Metzger, M., Schwartz, T. (1995). Microbiological Research 150:337-346. The synthetic plasmid pfdC1 with the replication origin of phage fd and fd gene 2 grows autonomously in E. coli cells. DNA sequencing revealed several mutations compared to the fd genome causing reduced expression of viral gene 2 protein, which can be toxic for the host cell. Another adaptation was noticed for E. coli strains with a copy of fd gene 2 on the F-episome and a pfdA-plasmid with a minimal fd replication origin, when maintained at 42 degree C. The carrier cells adjusted their cellular metabolism to these stress conditions, whereas replication functions of the plasmid or expression of fd gene 2 on the F-episome were not changed. The filamentous bacteriophages tend to reduce their genome size into miniphages, which was also observed for phages with an antibiotic resistance gene. Bacteriophages with a transposon insertion in the viral gene 2 had a tendency to restore the mutated gene by exchange with the functional gene 2 carried in recA-host cells. Mobilization of pfd- plasmids with RP4 transfer functions was reduced due to interference of replication and transfer in the rolling circle mode. The vectors used in these studies can also be applied as cloning vectors, which are compatible with many other plasmid vectors. [TOP OF PAGE]
- Reverse transcription PCR to detect enteroviruses in surface water. Gilgen, M., Wegmuller, B., Burkhalter, P., Buhler, H.P., Muller, U., Luthy, J., Candrian, U. (1995). Appl. Environ. Microbiol. 61:1226-1231. [TOP OF PAGE]
- A study on cyanophages inhibiting the growth of algae producing musty odor. Goto, Y., Kitayama, M. (1995). Water Supply 13:263-266. Recently blue-green algae have grown in large amount in the Lake Biwa. Authors have carried out a study on the cyanophages, which use Phormidium tenue (P. tenue), blue-green alga that produce musty odor in the Lake Biwa, as host and inhibit their growth. The samples used consisted of the surface-layer water in the Lake or the surface running water in Kizu River and Katsura River. A plate culture test by using the double-layered agar method was used in order to detect cyanophages, and the generation of plaque was observed. And, in order to confirm that the cyanophages inhibit the growth of P. tenue, authors also realized a liquid culture test, and observed the growth characteristics of the host. For the plate culture test, three samples presented the formation of plaque. In the liquid culture test, the growth of P. tenue was found to have been inhibited in the three samples. But for all these three samples, P. tenue was not completely killed; therefore, these cyanophages were believed to be temperate phages. By using these cyanophages is expected to be able to inhibit the growth of P. tenue alone without inhibiting the growth of other algae. [TOP OF PAGE]
- Bacterioides fragilis and Escherichia coli bacteriophagesExcretion by humans and animals. Grabow, W.O.K., Neubrech, T.W., Holtzhausen, C.S., Jofre, J. (1995). Water Science & Technology 31:223-230. [TOP OF PAGE]
- Efficiency of the Euroguard domestic water treatment unit with regard to viruses, phages and bacteria. Grabow, W.O.K., Wyn-Jones, A.P., Schildhauer, C., Jofre, J. (1995). Water S A (Pretoria) 21:71-74. The reduction in numbers of human viruses as well as bacteria and phages in water treated by the commercial Euroguard water filtercum-purifier for the domestic treatment of drinking water was evaluated. Drinking water seeded with laboratory strains of viruses, bacteria and phages which indicate faecal pollution, as well as sewage-contaminated river water and secondary treated waste water containing naturally occurring organisms, were passed through the unit which consists of a candle prefilter, activated carbon filter and ultraviolet irradiation compartment. At the prescribed flow rate of not more than 1 l cntdot min-1, numbers of poliovirus, hepatitis A virus, adenovirus types 40 and 4 1, rotavirus SA11, human rotavirus, coliphage MS2, somatic coliphages, Escherichia coli, Streptococcus faecalis, Clostridium perfringens, total coliform bacteria, faecal streptococci and the heterotrophic plate count were reduced by more than 99.99% in all waters tested. In all test runs, including those on secondary waste water which was not intended to be used in the unit and represents a "worst-case" situation in practice, the quality of the treated water was well within microbiological limits of international specifications for drinking water. [TOP OF PAGE]
- Seasonality and extinction in chaotic metapopulations. Grenfell, B.T., Bolker, B.M., Kleczkowski, A. (1995). Proc. R. Soc. Lond. B 259:97-103. A body of recent work has used coupled logistic maps to show that these model metapopulations show a decrease in global extinction rate in the chaotic region of model behaviour. In fact, many of the main ecological candidates for low-dimensional chaos are continuous-time host-parasite and predator-prey systems, driven by strong seasonal forcing of one or more population parameters. This paper, therefore, explores the relation between seasonal forcing and metapopulation extinction for such systems. We base the analysis on extensive simulations of a stochastic metapopulation model for measles, based on a standard compartmental model, tracking the density of susceptible, exposed, infectious and recovered individuals (the SEIR model). The results show that, by contrast with coupled logistic maps, the increased seasonality which causes chaos maintains or increases levels of global extinction of infection, by increasing the synchrony of sub-population epidemics. The model also illustrates that the population interaction (here between susceptible and infective hosts) has a significant effect on patterns of synchrony and extinction. [TOP OF PAGE]
- Characterization of Serratia entomophila bacteriophages and the phage-resistant mutant strain BC4B. Grkovic, S., O'Callaghan, M., Mahanty, H.K. (1995). Appl. Environ. Microbiol. 61:4160-4166. Successful large-scale fermentations of the bacterium Serratia entomophila for use in biological control of the soil-dwelling insect Costelytra zealandica has required the development of a phage-resistant mutant, BC4B. We report our investigations into S. entomophila phages and the nature of the phage resistance mechanism of strain BC4B. The parental strain of BC4B, A1M02, was found to contain two previously unidentified prophages, vphi-9A and vphi-9B, which were UV inducible and also released spontaneously in large numbers. BC4B was shown to be completely cured of vphi-9A. Single lysogens of vphi-9A and vphi-9B were not homoimmune to any other S. entomophila phages. However, on the basis of DNA-DNA homology, all S. entomophila phages except vphi-CW3 were shown to have significant regions of homology and also packaged their DNA via pac-like mechanisms. The failure of phage particles to adsorb was identified as the basis of phage resistance in BC4B. In addition, it was demonstrated that all known S. entomophila phages are naturally temperature sensitive. [TOP OF PAGE]
- Extremo-phage: In vitro selection of tolerance to a hostile environment. Gupta, K., Lee, Y., Yin, J. (1995). J. Mol. Evol. 41:113-114. Extremophiles are microorganisms that thrive under extreme conditions such as temperatures above 65 degree C, pHs below 4 or above 10, salt concentrations above 0.5 M, or pressures of 600 atm. While studies of enzymes either isolated from extremophiles, or generated using site-specific mutagenesis, or adapted by in vivo or in vitro selection have established a precedent for the engineering and application of proteins at extreme conditions, generalization of the approaches to more complex multimolecular or multitask systems has remained elusive. Here we demonstrate that a significantly more complex system-a bacteriophage-can over a number of generations be adapted to tolerate a hostile and unnatural environment. An in vitro selection strategy was used to adapt phage to urea, a protein denaturing agent. As the concentration of urea employed in selections over 20 generations was gradually increased from 5 to 9 m, the surviving phages steadily improved their tolerance, finally achieving a greater than 350-fold stability enhancement over the original population. [TOP OF PAGE]
- Comparing predator-prey models to Luckinbill's experiment with Didinium and Paramecium. Harrison, G.W. (1995). Ecology 76:357-374. When Leo Luckbill (1973) grew Paramecium aurelia together with its predator Didinium nasutum in 6 ml of standard cerophyl medium, the Didinium consumed all the prey in a few hours. When the medium was thickened with methyl cellulose, the populations went through two or three diverging oscillations lasting several days before becoming extinct. When he used a half-strength cerophyl medium thicked with methyl cellulose, the populations maintained sustained oscillations for 33 d before the experiment was terminated. The data from this experiment provide a rare opportunity to test current predator-prey models. ¶ A standard differential equation predator-prey model with a carrying capacity for the prey and a saturating (Type 2) functional response predicts the outcome of Luckinbill's experiment qualitatively, but does not give a good quantitative fit to the data. Several modifications of this model are tested against the data for the populations grown in the medium thickened with methyl cellulose, using the Marquardt-Levenberg method to obtain the least squares best fit. Neither Leslie type models nor models with a ratio-dependent functional response do well, but adding either predator mutual interference or a sigmoid (Type 3) functional response improves fit dramatically. Modeling the predator growth rate to depend on energy or nutrient storage instead of directly on the rate of consumption of prey, thus creating a delayed numerical response, along with predator mutual interference or a sigmoid functional response, produced the best models and gave excellent fits to the data. These models are further validated by the fact that changing only one or two parameter values to reflect the unthickened medium or the half-strength medium also gives reasonably good fits to the other two data sets. The last model requires a more sigmoid functional response to fit the data in the thickened than in the unthickened medium, suggesting that an increase in the cost-benefit ratio of energy spent searching to energy gained capturing prey inhibits the predator searching at low prey densities. [TOP OF PAGE]
- Removal and inactivation of viruses by drinking-water treatment process under full-scale conditions. Havelaar, A.H., Vanolphen, M., Schijven, J.F. (1995). Water Science & Technology 31:55-62. [TOP OF PAGE]
- Study on Pseudomonas aeruginosa Cytotoxin and Cytotoxin-Converting Phages. Hayashi, T. (1995). Japanese Journal of Bacteriology 50:391-401. [TOP OF PAGE]
- Significance of bacteriophages for controlling bacterioplankton growth in a mesotrophic lake. Hennes, K.P., Simon, M. (1995). Appl. Environ. Microbiol. 61:333-340. Bacterium-specific viruses have attracted much interest in aquatic microbial ecology because they have been shown to be about 10 times more abundant than planktonic bacteria. So far most of the studies of interactions of planktonic bacteria and viruses have been done in marine environments, and very little is known about these interactions in lakes. Therefore, we studied phage proliferation in Lake Constance, a large mesotrophic lake in Germany. We enumerated bacteria and quantified the fraction of bacteria with mature intracellular phage particles and the number of free viruses by transmission electron microscopy. Between the end of March and early August 1992, peaks of bacterial abundance were followed in 1 to 2 weeks by peaks in the fraction of bacteria containing visible phage particles (0 to 1.7%) and in the number of free viruses (1 times 10-7 to 4 times 10-7 ml-1). We estimated that 1 to 17% +- 12% of all bacteria were phage infected, implying that phage-induced mortality was lt 34% +- 24% of total mortality. A direct comparison between phage-induced mortality, the net decrease of bacterial numbers, and bacterial growth rates indicated that phage-induced mortality accounted for lt 11% of total bacterial mortality during the phytoplankton spring bloom and 18 to 21% following the bloom. Estimated burst sizes ranged from 21 to 121 phages. Phage production rates of 0.5 times 10-6 to 2.5 times 10-6 ml-1 day-1 accounted for 70 to 380% of the observed net increase rates of free phages, implying high rates of simultaneous phage decay. The cyclic dynamics between bacteria and phages and the varying size structure of the intracellular mature phage particles suggested that phage infection was important in structuring the bacterial host assemblage during the study period. [TOP OF PAGE]
- Direct counts of viruses in natural waters and laboratory cultures by epifluorescence microscopy. Hennes, K.P., Suttle, C.A. (1995). Limnol. Oceanogr. 40:1050-1055. Epifluorescent microscopy was used to determine the abundance of viruses in samples from marine and freshwater environments and in laboratory cultures that were filtered onto 0.02-µm pore-size filters and stained with a cyanine-based dye (Yo-Pro-1). Estimates of viral abundance based on Yo-Pro stained samples were 1.2 to 7.1 times greater than estimates obtained using transmission electron microscopy (TEM). Moreover, the precision of the Yo-Pro based method was much greater than that for TEM (coefficient of variation 7 % versus 20 %, respectively). DNase treatment of samples did not result in lower numbers of particles that could be stained by Yo-Pro, suggesting that the fluorescence was not the result of nucleic acids associated with the surface of particles. These results indicate that the concentration of viruses in natural waters may be higher than previously recognized and imply that the TEM-based method significantly underestimates virus abundance. Virus abundances ranged from 107 to > 108 ml-1 in surface waters along a transect in the western Gulf of Mexico to 109 ml-1 in water overlying a submerged cyanobacterial mat. High counting efficiency, ease of preparation, modest equipment requirements and the possibility of preparing specimens for long-term storage, make the Yo-Pro based method ideal for routine environmental analysis. [TOP OF PAGE]
- Fluorescently labeled virus probes show that natural virus populations can control the structure of marine microbial communities. Hennes, K.P., Suttle, C.A., Chan, A.M. (1995). Appl. Environ. Microbiol. 61:3623-3627. Fluorescently stained viruses were used as probes to label, identify and enumerate specific strains of bacteria and cyanobacteria in mixed microbial assemblages. Several marine virus isolates were fluorescently stained with YOYO-1 or POPO-1 (Molecular Probes, Inc.) and added to seawater samples that contained natural microbial communities. Cells to which the stained viruses adsorbed were easily distinguished from non-host cells; typically, there was undetectable binding of stained viruses to natural microbial assemblages containing >106 bacteria ml-1, but to which host cells were not added. Host cells that were added to natural seawater were quantified with 99 ± 2 % efficiency using fluorescently labeled virus probes (FLVPs). A marine bacterial isolate (strain PWH3a) was introduced into natural microbial communities that were either supplemented with nutrients or untreated, and changes in the abundance of the isolate were followed using FLVPs. Simultaneously, the concentration of viruses that infected strain PWH3a was monitored by plaque assay. Following the addition of PWH3a, viruses infecting this strain increased from undetectable levels (<1 ml-1 to 2.9 x 107 ml-1 and 8.3 x 108 ml-1 for the untreated and nutrient-enriched samples, respectively. The increase in viruses was associated with a collapse in populations of strain PWH3a from ca. 30% to 2% and 43% to 0.01% of the microbial communities in untreated and nutrient-enriched samples, respectively. These results clearly demonstrate that FLVPs can be used to identify and quantify specific groups of bacteria in mixed microbial communities. As well, the data show that viruses which are present at low abundances in natural aquatic viral communities can control microbial community structure. [TOP OF PAGE]
- Isolation of FC3-11, a bacteriophage specific for the Klebsiella pneumoniae porin OmpK36, and its use for the isolation of porin-deficient mutants. Hernandez Alles S, Alberti, S., Rubires, X., Merino, S., Tomas, J.M., Benedi, V.J. (1995). Canadian Journal of Microbiology 41:399-406. FC3-11, a bacteriophage specific for the Klebsiella pneumoniae porin OmpK36, was isolated by its ability to infect Escherichia coli strains expressing the cloned OmpK36 porin. Porin OmpK36 was shown to be the receptor for phage FC3-11 by the observations that K. pneumoniae and E. coli strains that do not express OmpK36 were resistant to phage FC3-11, the purified porin inactivated the phage, and mutants selected for FC3-11 resistance had lost OmpK36. The outer membrane protein OmpK35 was isolated from a K. pneumoniae phage-resistant mutant by using porin isolation methods and was shown to contain an N-terminal sequence typical of enterobacterial porins. Bacteriophage FC3-11, alone or in combination with previously described lipopolysaccharide-specific phages, is a valuable tool to obtain OmpK36-porinless mutants. [TOP OF PAGE]
- Characterization of Lactococci other than Lactococcus lactis for Possible Use as Starter Cultures. Holler, B.J., Steele, J.L. (1995). International Dairy Journal 5:275-289. The objective of this study was to examine lactococcal species other than Lactococcus lactis ssp. lactis and Lactococcus lactis ssp. cremoris for their ability to serve as starter cultures. To identify the most promising cultures, resistance to L. lactis-derived bacteriophage, lack of inhibitor production, ability to metabolize lactose, and acid production in milk supplemented with glucose and casein hydrolysate were examined. The results of these analyses lead to three L. raffinotactis strains being chosen for further characterization. The L. raffinolactis strains were determined to: produce acceptable levels of acetaldehyde and diacetyl; be incapable of growth at 40 degree C; survive eight growth cycles against laboratory and industrial phage cocktails; contain one or no plasmids; and lack a caseinolytic proteinase. A plasmid expressing the Lactococcus lactis ssp. cremoris Wg2 caseinolytic proteinase was introduced into L. raffinolactis 617; however, no detectable caseinolytic proteinase activity was observed in the resulting transformants. [TOP OF PAGE]
- Small extrachromosomal nucleic acid segments in protozoan parasites. Hotzel, I., Kabakoff, R., Ozaki, L.S. (1995). Veterinary Parasitology 57:57-60. Viruses have been described in the following protozoa: Babesia spp., Trichomonas vaginalis, Giardia lamblia, Leishmania braziliensis and Eimeria spp. In order to study the Babesia bovis virus, merozoites have been prepared from the blood of infected cattle. Agarose gel electrophoresis of nucleic extracts from the bovine protozoa B. bovis and Babesia bigemina were separated into genomic DNA and at least two additional nucleic acids. One molecule with a relative mobility of 5.5 kilobase pairs (kbp) was identified as a double-stranded RNA virus-like particle. Another 6.2 kbp DNA molecule had sequences related to mitochondrial genome. [TOP OF PAGE]
- Genotyping male-specific RNA coliphages by hybridization with oligonucleotide probes. Hsu, F.-C., Shieh, Y.-S.C., van Duin, J., Beekwilder, M.J., Sobsey, M. (1995). Appl. Environ. Microbiol. 61:3960-3966. [TOP OF PAGE]
- Mitomycin C induction of bacteriophages from Serpulina hyodysenteriae and Serpulina innocens. Humphrey, S.B., Stanton, T.B., Jensen, N.S. (1995). FEMS Microbiol. Let. 134:97-101. A prophage was induced from cells of the pathogenic spirochaete Serpulina hyodysenteriae using mitomycin C. Five to seven hours after mitomycin C was added (8 mu-g/ml, final concentration) to S. hyodysenteriae B204 cultures in BHIS broth (OD-620 = 0.9) cell lysis was detected as a decrease in culture optical density. Bacteriophage particles attached to whole cells and to cell debris were detected by electron microscopic analysis of negatively stained (2% PTA, pH 7.0) bacteria harvested by centrifugation from mitomycin C treated cultures. The phage particles consisted of a head (45 nm diameter) and a tail (64 nm times 9 nm). Bacteria from untreated cultures lacked phages detectable by electron microscopy. The appearance of bacteriophage particles in mitomycin C treated cultures correlated with the appearance of extrachromosomal DNA, 7-8 kb in size as estimated by agarose gel electrophoresis, in DNA preparations from treated S. hyodysenteriae cells. When cultures of other S. hyodysenteriae strains (B78, B169, A-1, B8044, B6933. Ack300/8, R-1) and S. innocens 4/71 in BHIS were treated with mitomycin C (8-15 mu-g/ml, final concentration), phages similar in morphology and size to the S. hyodysenteriae B204 phage were induced. [TOP OF PAGE]
- [Does taxis exist in bacterial viruses?]. [Review] [Russian]. Ivanitskii, G.R., Medvinskii, A.B., Deev, A.A., Khusainov, A.A., Tsyganov, M.A. (1995). Biofizika 40:60-73. By way of example of interaction of T4 bacteriophage with E. coli bacterium the scenario of enhancement of sorption of phages on bacteria through the remote mechanism of their cyclic interaction has been considered. An enlargement of the typical phage size, when its fibrillae are opened, underlies this mechanism. Modification of the structure of phages also occurs through the medium by release of products of bacterial metabolism into it. Allied questions related to investigation of physicochemical and biological processes, which require to take into account "fluffing" of microparticles. The medium-induced change of volume of microparticles leads to spatial cooperative effects with non-linear dynamics. Such phenomena are possible in all diffusional processes in biology, chemistry and physics. [TOP OF PAGE]
- Baseplate as a logical controller between the reception and the transformation of bacteriophage T4. Ivanitskii, G.R., Khusainov, A.A., Deev, A.A., Dawson, K. (1995). Biofizika 40:1265-1280. It has been shown that the complex functioning of the baseplate of the bacteriophage T4 is based on the high level hierarchy in the structure organization and on the interaction of protein components forming the hub and the "channels" of short and long fibers. The presence of structure proteins with stabilizing and destabilizing functions has been revealed. It has been shown that the process of binding of long tail fibers with cell receptors is a cooperative process. In general the baseplate can be considered as a logic module providing the transition from the adsorption to the nonreversible reorganization in the bacteriophage functioning. [TOP OF PAGE]
- Evaluation of indicators for assessment of human and animal faecal pollution of surface run-off. Jagals, P., Grabow, W.O.K., De Villiers, J.C. (1995). Water Science and Technology 31:235-241. [TOP OF PAGE]
- Viral contribution to dissolved DNA in the marine environment as determined by differential centrifugation and kingdom probing. Jiang, S.C., Paul, J.H. (1995). Appl. Environ. Microbiol. 61:317-325. Dissolved or filterable (<0.2- mu m-pore-size filter) DNA is a ubiquitous component of the dissolved organic matter in the surface waters of this planet. In an effort to understand the composition and possible sources, we subjected dissolved DNA concentrated by vortex flow filtration from offshore and coastal environments to differential centrifugation and probing with 16S rRNA-targeted kingdom oligonucleotide probes. Initial studies with calf thymus soluble DNA and T2 phage particles indicated that high-speed ultracentrifugation (201,000 x g for 90 min), a method to separate viral particles from soluble DNA used by other investigators, resulted in pelleting of nearly all the DNA and virus particles. Lower-speed centrifugation (11,200 to 25,800 x g for 90 min) resulted in >99% of the virus particles being collected in the pellet and similar to 65% of the calf thymus DNA remaining in the supernatant. Employing this approach, we estimate that approximately 50% of the filterable DNA from marine environments is truly soluble or free DNA and that the other half is composed of bound forms (viral particles and, potentially, colloids). Of the bound form, 17 to 30% could be accounted for by viral particles, by calculating the amount of viral DNA on the basis of viral abundance, leaving a portion of the bound form uncharacterized. Kingdom probing with universal, eubacterial, and eucaryotic probes indicated that dissolved DNA hybridized with all of these probes, while purified standard viral DNAs did not, or hybridized only slightly with the universal probe (tailed oligonucleotide only). Collectively, these data indicate that DNA in viral particles is a small component of the dissolved DNA, the majority being of eubacterial and eucaryotic origin. [TOP OF PAGE]
- Isolation and characterization of a temperate bacteriophage from a ruminal acetogen. Jiang, W.H., Patterson, J.A., Steenson, L.R. (1995). Current Microbiology 31:336-339. Nine acetogenic bacterial cultures recently isolated from the bovine rumen were tested for phage susceptibility by plaque formation. Both clear plaques and plaques with turbid centers were occasionally seen, but could not be used repeatedly to lyse pure cultures of acetogens, suggesting the possibility of a temperate phage. Five of the nine acetogenic isolates showed a response to mitomycin C induction. Acetogenic isolate H3HH was chosen for further study because it produced the greatest lysogenic response to mitomycin C. The bacteriophage was induced with mitomycin C, examined by transmission electron microscopy, and shown to have a hexagonal head (diameter, 59 eta-m), a long flexible tail (192 eta-m), and a flat collar (diameter, 31 eta- m). The bacteriophage was classified within Bradley's group B. Bacteriophage DNA was determined to contain 36.2 kilobases of linear double-stranded DNA. [TOP OF PAGE]
- Bacteriophage removal in water-treatment plants. Jofre, J., Ollé, E., Ribas, F., Vidal, A., Lucena, F. (1995). Water Science & Technology 31:69-73. [TOP OF PAGE]
- Potential usefulness of bacteriophages that infect Bacteroides fragilis as model organisms for monitoring virus removal in drinking water treatment plants. Jofre, J., Olle, E., Ribs, F., Vidal, A., Lucena, F. (1995). Appl. Environ. Microbiol. 61:3227-3231. The presence of bacteriophages at different stages in three drinking water treatment plants was evaluated to study the usefulness of phages as model organisms for assessing the efficiency of the processes. The bacteriophages tested were somatic coliphages, F-specific coliphages, and phages infecting Bacteroides fragilis. The presence of enteroviruses and currently used bacterial indicators was also determined. Most bacteriophages were removed during the prechlorination- flocculation-sedimentation step. In these particular treatment plants, which include prechlorination, phages were, in general, more resistant to the treatment processes than present bacterial indicators, with the exception, in some cases, of clostridia. Bacteriophages infecting B. fragilis were found to be more resistant to water treatment than either somatic or F-specific coliphages or even clostridia. Enteric viruses were found only in untreated water in low numbers, and consequently, the efficiency of the plants in the removal of viruses could not be evaluated with precision. The numbers and frequencies of detection of the various microorganisms in water samples taken in the distribution network served by the three plants confirm the results found in the finished water at the plants. [TOP OF PAGE]
- Association between the mollusc bivalve Loripes lucinalis and a Chlamydia-like organism, with comments on its pathogenic impact, life cycle and possible mode of transmission. Johnson, M.A., Le Pennec, M. (1995). Marine biology. Berlin 123:523-530. Loripes lucinalis is a littoral bivalve which has already been confirmed to harbour endo-cellular sulfur-oxidizing bacteria within its gills. Examination of the digestive gland of L. lucinalis collected from the Moulin Blanc Beach in the Bay of Brest (Brittany, France) revealed the existence of an additional association involving a Chlamydia-like organism. Three different forms of Chlamydia-like bacteria were observed: reticulate rod-shaped cells, electron-dense cells and enlarged cells. The reticulate rod-shaped cells and the electron-dense bodies are thought to represent the germinal initial body and infectious form of the bacteria, respectively. The enlarged cells were always associated with what are believed to be spherical or icosahedral phages. Initial infestation seems to occur by phagocytosis at the apical pole of the digestive cells of the tubule and duct epithelia. Within the host cell, the bacteria undergo binary fission and budding, forming an inclusion which gradually fills up the cell. Inclusions are generally between 15 and 30 mu m in size, and >85% of all individuals examined possessed inclusion bodies. The level of infestation varied between individuals, some being heavily colonized, but did not seem to be related to season. Histological and ultrastructural observations suggest that, once developed, the colony has three possible fates: (1) the cells will degenerate due to phage infection; (2) colony overcrowding will occur, causing the development of electron-dense bodies that will be released into the lumen; (3) the entire membrane-bound inclusion will be released into the lumen and subsequently into the pallial cavity. Inclusions within the pallial cavity may be ingested by the host or may even be phagocytized by bacteriocyte cells of the gill. It is proposed that this association could be a form of symbiosis and that L. lucinalis may, therefore, be a rare example of an organism adapted to harbour two very different symbioses. [TOP OF PAGE]
- Inactivation of Lactobacillus bacteriophage PL-1 by microwave irradiation. Kakita, Y., Kashige, N., Murata, K., Kuroiwa, A., Funatsu, M., Watanabe, K. (1995). Microbiology and Immunology 39:571-576. The effect of microwave irradiation on the survival of bacteriophage PL-1, which is specific for Lactobacillus casei, was studied using a commercial 2,450 MHz microwave oven. The phages were inactivated by microwave irradiation according to almost first-order reaction kinetics. The rate of phage inactivation was not affected by the difference in the continuous or intermittent irradiation, nor by the concentrations of phages used, but was affected by the volume of phage suspensions, which prevented the loss of generated heat. Microwave irradiation of phage suspensions produced a number of ghost phages with empty heads, but fragmentation of the tail was hardly noticed. The breakage of phage genome DNA was primarily caused by the heat generated by microwave irradiation, whereas the phage DNA was not affected by the same temperature achieved by heat from outside. Thus we concluded that the phage-inactivating effect of microwave irradiation was mainly attributed to a thermal microwave effect, which was much stronger than a simple thermal exposure. [TOP OF PAGE]
- [Viruses of parasitic protozoa]. [Polish]. Kasprzak, W., Majewska, A.C. (1995). Wiadomosci Parazytologiczne 41:131-137. The authors present the actual review on several publications concerning the molecular characterizations of the viruses found in parasitic protozoa such as Giardia, Trichomonas, Leishmania and Entamoeba histolytica. All of the RNA viruses observed in parasitic protozoa showed several similarities and did not considerably differ from the viruses found in simple eukaryotic cells; they closely correspond to dsRNA viruses of yeast. The supposition that the protozoan symbionts detected in laboratories transfer to their hosts in natural conditions seemed to be rational, though, there are no evidences that these symbionts are potential pathogens. However, the opinion reiterates that intestinal protozoa (e.g. Entamoeba histolytica) may serve as vectors for HIV or cofactors of HIV infection. The authors point out that irrespective of the potential role of viruses as vectors in the transfection system for parasitic protozoa, the observed viral system constitutes an unusual experimental system to solve the problems of gene expression. [TOP OF PAGE]
- [Viruses of parasitic protozoa]. Kasprzak, W., Majewska, A.C. (1995). Wiadomosci Parazytologiczne 41:131-137. The authors present the actual review on several publications concerning the molecular characterizations of the viruses found in parasitic protozoa such as Giardia, Trichomonas, Leishmania and Entamoeba histolytica. All of the RNA viruses observed in parasitic protozoa showed several similarities and did not considerably differ from the viruses found in simple eukaryotic cells; they closely correspond to dsRNA viruses of yeast. The supposition that the protozoan symbionts detected in laboratories transfer to their hosts in natural conditions seemed to be rational, though, there are no evidences that these symbionts are potential pathogens. However, the opinion reiterates that intestinal protozoa (e.g. Entamoeba histolytica) may serve as vectors for HIV or cofactors of HIV infection. The authors point out that irrespective of the potential role of viruses as vectors in the transfection system for parasitic protozoa, the observed viral system constitutes an unusual experimental system to solve the problems of gene expression. [TOP OF PAGE]
- [The bacteriophage lysis-susceptibility properties of Vibrio cholerae strains isolated in separate regions of Dagestan in 1994]. [Russian]. Kazakova, E.S., Abramova, E.G., Makkaeva, A.M., Luk'ianova, O.I., Naumov, A.V., Adamov, AK (1995). Zhurnal Mikrobiologii, Epidemiologii i Immunobiologii Suppl 2:78-80. The study of the properties of V. cholerae strains isolated in June-September 1994 in the Daghestan revealed that they belonged, according to their specific properties, to typical representatives of V. eltor, serovar Ogawa, but a great part of them (67.2%) was not lysed by diagnostic cholera bacteriophages. Experiments with different batches of diagnostic cholera bacteriophages showed the necessity of their further improvement. [TOP OF PAGE]
- Viral inactivation by potassium ferrate. Kazama, F. (1995). Water Science and Technology 31:165-168. [TOP OF PAGE]
- Genetic diversity of related vibriophages isolated from marine environments around Florida and Hawaii, USA. Kellogg, C.A., Rose, J.B., Jiang, S.C., Thurmond, J.M., Paul, J.H. (1995). Mar. Ecol. Prog. Ser. 120:89-98. Although viruses from the marine environment have been enumerated, isolated, and characterized, there is little information on the abundance or global distribution of specific phage types. To this end, we studied the abundance and distribution of phages which infect a marine bacterium isolated from Tampa Bay (Florida, USA), tentatively identified (Microbial ID, Inc., Newark, Delaware, USA) as Vibrio parahaemolyticus. Using this host, we have isolated over 60 phages from the Gulf of Mexico, Tampa Bay, Florida Keys, and Oahu, Hawaii (USA). These isolates are all Myoviridae, with head sizes ranging from 50 +- 0.0 to 65 +- 4.2 nm and tail lengths of 60 +- 3.6 to 100 +- 5.0 rim. The type phage (PHI-16 from Tampa Bay) has a double-stranded DNA genome of 51 to 58 kb. A 1.5 kb EcoRI fragment of this genome has been cloned and used as a gene probe. All of the DNA from the phage isolates hybridized to this probe under stringent conditions, but not to DNA from other marine vibriophages and bacteriophages, suggesting genetic relatedness. Agarose gel electrophoresis of EcoRI digests of the DNAs, followed by Southern transfer and probing with the 1.5 kb gene probe, yielded 6 groups based upon banding patterns. These groups were not segregated geographically within the Florida isolates; however, all of the Hawaiian phages had a common restriction pattern. These data indicate that populations of genetically related phages are widely distributed over large geographic distances in the oceans. [TOP OF PAGE]
- Reduction of the concentration of bacteria and coliphages along the flowing stretch of a treated sewage channel. Koerner, S., Dizer, H., Lopez-Pila, J.M. (1995). Acta Hydrochimica et Hydrobiologica 23:264-270. The efficiency of surface waters to eliminate E. coli, fecal streptococci, Salmonella spp., and coliphages was evaluated in a small river which receives treated wastewater and which is rich in submerged macrophytes. The study took place between April and December, 1994. Total colony count, BOD-5, O-2 concentration and water temperature were determined in the river as well. As the river does not receive additional water downwards along its 17.2 km course, dilution effects could be ruled out as the cause for the elimination of the microorganisms. The reduction is assumed to happen rather due to sedimentation, grazing, and adsorption to the submerged waterplants. Immediately after discharge of the wastewater, the river water contained about 10-5 cfu/ 100 mL E. coli and 10-4 cfu/ 100 mL fecal streptococci, about 1000 pfu/100 mL coliphages, and, as a rule, was positive for salmonella in 10 mL. The reduction of E coli, fecal streptococci, salmonella, clostridia, and coliphages at the end of the course was 1 to 2 orders of magnitude. This reduction took place mainly within the first 4.7 km, a part in which, due to low flowing velocities. suspended solids settle down efficiently. Besides, at the end of this part the submerged waterplants are especially abundant. The reduction of suspended solids correlated positively with that of BOD-5, bacteria. and coliphages. The reduction of microorganisms was not sufficient to fulfill the requirements of the European Community guidelines for bathing waters and for surface waters used as drinking water source. The regenerating capacity of surface waters is not sufficient to eliminate pathogens from conventionally treated wastewater. Therefore, tertiary treatment is necessary to keep receiving waters reasonably free from pathogens. [TOP OF PAGE]
- Whole-virus vaccine development by continuous culture on a complementing host. Kong, D., Yin, J. (1995). Bio/Technology 13:583-586. We have evaluated an adaptive strategy for generating whole-virus vaccines using a bacteriophage model. Wildtype phage T7 was cultivated in a two-stage continuous stirred-tank reactor (CSTR) utilizing a recombinant E. coli host that constitutively expressed T7 RNA polymerase, an essential enzyme of the early viral metabolism. Over the course of 180 generations a diversity of phage variants emerged, outgrew the wildtype, and were subsequently eclipsed by yet fitter variants, based on host-ranges, restriction patterns, and one-step growth responses of isolated clones. The fittest variant, which required complementation by the recombinant host in order to grow, deleted at least 12 percent of its genome and replicated twice as fast as the wildtype. Moreover, this variant was immunogenically indistinguishable from the wildtype, based on cross-reactivities of antisera raised against both. These results suggest the feasibility of the proposed strategy for the development of safe whole-virus vaccines. [TOP OF PAGE]
- The ecological concept of parasitism [Russian]. Krasnoshchekov, G.P. (1995). Zhurnal Obshchei Biologii 56:18-32. Analysis of morpho-ecological adaptations of parasites showed that their necessary and sufficient characteristic is their inhabiting the host environment. Integration with the environment is achieved 1) by adaptations towards a particular habitat (first order environment) at certain phases of onthogenesis, and 2) by adaptations to the aggregate of hosts, their ecology and factors regulating the numbers of parasites (second order environment) at the level of their entire life cycle. The evolutionary progress of parasites is sustained by the increase in their independence from extrinsic factors not by means of general organization complication and integration (as in free-living animals), but by elimination of free-living developmental stages and by increase of integration with the host environment. The basis of the latter is formed by ecological adjusting of parasites to the environment. It is achieved by syncytial transformation of the covers and the use of communication means analogous to those of host cells. The consequence of host-parasite integration is the transition of parasites from resource consumption to the management of the environment. It is manifested by their influence on defensive reactions and other functions of the organism, as well as on its behavior and ecology. Parasitism may turn into other forms of coexistence (commensalism, mutualism) in the course of coevolution, as a result of dialectical overcoming of antagonistic interactions of the two partners. [TOP OF PAGE]
- Introduction of Pseudomonas aeruginosa mutator phage D3112 into Alcaligenes eutrophus strain CH34. Krylov, V., Merlin, C., Toussaint, A. (1995). Res. Microbiol. 146:245-250. We have investigated the possibility of growing mutator phages from Pseudomonas aeruginosa on various isolates of Alcaligenes eutrophus. Although none out of 10 A. eutrophus strains were susceptible to infection with any of the phages tested, phage D3112 could be readily transferred in our model strain CH34 by means of an RP4::D3112 plasmid. CH34/RP4::D3112 lysogenes were stable and produced phages. However, neither mitomycin C nor UV treatment increased the phage yield. [TOP OF PAGE]
- Mucoid clones of Pseudomonas aeruginosa PAO1 surviving after induction of transposable prophages. Krylov, V.N., Solov'eva, T.I., Burkal'tseva, M.V. (1995). Genetika 31:1375-1379. The origin and properties of mucoid clones were studied. The clones were selected with high frequency after thermoinduction of Pseudomonas aeruginosa lysogenic for phage-transposons (PT). The production of alginate does not promote the survival of lysogenic bacteria at 42degreeC. Mucoid clones were shown to appear before thermoinduction; the frequency of their formation does not depend on the specificity of the mutator effect intrinsic to different PT. Phenotypic differences typical of mucoid clones can be mediated by different mutations promoting clone survival at 42degreeC and by simultaneously arising additional mutations. The SL21 mucoid clone selected among clones of P. aeruginosa PAO1 resistant to PT of B3 possesses an additional trait of phage resistance at 42degreeC. The presence of D3112 cts 15 prophage has no significant effect on the frequency of SL21 reversion to nonmucoidness. This means that the mutator effect of PT has made a slight contribution to this process. The appearance of mutations promoting the survival of the thermoinducible lysogen SL21 (D3112 cts 15) does not affect the frequency of the loss of mucoidness. Nonmucoid derivatives of SL21 were shown to differ in phage resistance at 42degreeC and in the extent of the residual mucoidness manifested under specific conditions. Consequently, nonmucoid clones appear as a result of pseudoreversions. Because some of these pseudorevertants cannot again be convened to the mucoid form, it is concluded that they carry mutations in genes whose functions are obligatory for the production of alginate. [TOP OF PAGE]
- Cryptic transposable phages of Pseudomonas aeruginosa. Krylov, V.N., Mit'kina, L.N., Pleteneva, E.A., Aleshin, V.V. (1995). Genetika 31:1507-1511. Frequencies of nucleotide sequences homologous to phage transposons (PT) of two species, D3112 and B3, were assessed in genomes of natural Pseudomonas aeruginosa strains by the dot-blot hybridization method. These strains were incapable of liberating viable phages on a lawn of the PA01 standard indicator strain of P. aeruginosa. It was shown that the homologies detected belong to two groups, high and intermediate, with respect to homology level. Homology patterns were classified as high when they provided signals comparable to those for hybridization in a positive control; they were classified as intermediate when the hybridization level higher than the background level, but lower than in the positive control. Homologous PIT sequences were designated as cryptic PT. Intact cryptic PT prophages were shown to exist in genomes of particular natural strains manifesting a high level of hybridization. However, the growth of these phages was limited by the restriction system of strain PA01. It is possible to isolate strains maintaining the growth of a portion of cryptic PT. These strains differed from P. aeruginosa with respect to the specificity of the restriction and modification system. Nevertheless, in most cases, the attempt to identify a novel host capable of maintaining growth of a cryptic PT failed. Natural strains often carry cryptic PT related to both known PT species, D3112 and B3. The frequency of cryptic PT is extremely high, reaching 30% in only strains with a high level of homology and up to 50% in all strains exhibiting homology. This high PT frequency is assumed to be associated with the considerable variation of P. aeruginosa. [TOP OF PAGE]
- [The reasons for the resistance of Vibrio cholerae to diagnostic phages]. [Russian]. Kudriakova, T.A., Cherepakhina, I.I., Alekseeva, L.P., Makedonova, L.D., Evteeva, E.I., Dudkina, O.V., Burlakova, O.S., Vlasov, V.P., Gavrilov, B.V., Vodop'ianov, S.O., et al. (1995). Mikrobiolohichnyi Zhurnal 57:56-64. Phage resistance of 225 strains of cholera germs of O1 group obtained from different countries in 1988-1992 has been analyzed. Change of sensitivity to diagnostic phages was mostly connected with the decrease or loss of agglutinability in cholera sera. Phage resistance is rather conditioned by the change of the surface structures of the cell and by further change of phage reception zones. The increase in the number of strains sensitive to diagnostic phages after 6-12 months of storage evidenced for stabilization of cell wall structures and increase of their viability under relatively favourable conditions of storage. [TOP OF PAGE]
- Reasons of stability of cholera germs to diagnostic phages. Kudryakova, T.A., Cherepakhina, I.Y., Alekseeva, L.P., Makedonova, L.D., Evteeva, E.I., Dudkina, O.V., Burlakova, O.S., Vlasov, V.P., Gavrilov, B.V., Vodop'yanov, S.O., Sorokin, V.M. (1995). Mikrobiologichnyi Zhurnal 57:56-64. Phage resistance of 225 strains of cholera germs of O1 group obtained from different countries in 1988-1992 has been analyzed. Change of sensitivity to diagnostic phages was mostly connected with the decrease or loss of agglutinability in cholera sera. Phage resistance is rather conditioned by the change of the surface structures of the cell and by further change of phage reception zones. The increase in the number of strains sensitive to diagnostic phages after 6-12 months of storage evidenced for stabilization of cell wall structures and increase of their viability under relatively favourable conditions of storage. [TOP OF PAGE]
- Phagotyping of Bacillus thuringiensis. Kuzin, A.I., Azizbekyan, K.R. (1995). Biotekhnologiya 7-10. The preliminary scheme of phagotyping for identification of strains of Bacillus thuringiensis was developed. 10 phages from four groups which they had been attributed to according to their morphology and lytic spectrum were used for typing of strains of 42 serovariants of B. thuringiensis. Generally the allowance towards typing, that is the sensitivity to at least one phage, was 54.7 per cent. 19 strains were resistant to all phages. 17 different phagotypes were revealed. A correlation between serotyping and typical phage was not discovered. [TOP OF PAGE]
- Population dynamics in the co-culture of Shigella flexneri 1b original strain and its antigenic 3b mutant carrying a prophage. Lachowicz, T.M., Dziadkowiec, D., Kopocinska, I., Kopocinski, B. (1995). Microbios 83:89-106. The antigenic mutant Shigella flexneri 3b showed selective prevalence when subcultured with the original strain 1b. Mathematical analysis of such co-cultures showed that the dynamics of bacterial growth may be described by equations of the Lotka-Volterra type. The analysis of serial cultivations suggests that parameters of the equations may be realizations of random variables characterizing strains and media. The mutant carries a prophage lethal for the original strain. Distinctive features of the growth of these strains alone and in co-culture may be successfully explained by the differences in growth parameters, without phage inference. The concurrence model connected only with the existence of the phage is not sufficient. A complete description of the dynamics of the co-culture is obtained by the connection of the assumptions of two models: strains in competition and growth of strains with phage, given the random character of the parameters. [TOP OF PAGE]
- Induction of systemic resistance against fusarium wilt of radish by lipopolysaccharides of Pseudomonas fluorescens. Leeman, M., Van Pelt, J.A., Den Ouden, F.M., Heinsbroek, M., Bakker, P.A.H., Schippers, B. (1995). Phytopathology 85:1021-1027. In commercial greenhouse trials, Pseudomonas fluorescens strain WCS374 suppressed Fusarium wilt and increased radish yield. In bioassays, the involvement of lipopolysaccharides (LPSs) in induction of systemic resistance was studied. Induction of systemic resistance by selected plant growth-promoting rhizobacteria (PGPR) strains of P. fluorescens was involved in the suppression of Fusarium wilt of radish in a special rockwool bioassay. In this bioassay, the pathogen, Fusarium oxysporum f. sp. raphani, and the PGPR strain were inoculated at spatially separate locations on the plant root and were confined to these locations throughout the experiments. PGPR strains WCS374 and WCS417 of P. fluorescens and their crude cell wall extracts, which contained the LPS or purified LPS (consisting of lipid A/innercore/O-antigen side chain), induced systemic resistance, whereas P. putida WCS358 or its crude or purified LPS did not. Neither the phage-resistant mutants of WCS374 and WCS417 lacking the O-antigenic side chain of the LPS nor the crude or purified lipid A/innercore of these mutants reduced disease incidence in this experimental design. Strain WCS374, but not its O-antigen-minus mutant, also induced systemic resistance when applied on the cotyledon of radish on an agar disk cut from a plate culture. The pathogen was delivered on the root in peat 2 days later. Thus, the resistance-inducing O-antigen of strain WCS374 was effective not only onto the root, but also on the cotyledon. In a bioassay with greenhouse soil naturally infested with the Fusarium wilt pathogen of radish, strain WCS374, but not the O-antigen-minus mutant, suppressed disease. This suggests the involvement of induced resistance in natural soil bioassays and commercial greenhouse trials. [TOP OF PAGE]
- Removal of virus particles, bacteria and bovine serum albumin from water by steam-exploded Pinus radiata bark. Lewis, G.D., Lomax, T.D., Kimerley, M. (1995). Water Res. 29:1689-1693. Novel methods for removal of bacteria, viruses and high BOD material, such as proteins, from industry wastes and sewage, are of increasing interest particularly if they are able to harness waste materials from other industries. The washed, tannin-rich, material resulting from Pinus radiata bark treated by steam-explosion, has been investigated as a potential filtration medium for removing microorganisms and protein contaminants from water and waste water. The steam-exploded bark effectively removed a test virus (bacteriophage MS2) from dechlorinated tap water when used as a filtration medium ( gt 99.9%) or when stirred in suspension (99% within 10 min). Bacterial species (Escherichia coli and Enterococci faecalis) in the same experiments were removed well by filtration ( gt 99.9%) but stirring in bark suspension only reduced the initial titre by 55-62% within 10 min. Treatment of bovine serum albumin (100 mg/l and 700 mg/l) with steam-exploded bark in suspension removed up to 95% of the protein from solution. These results suggest that tannin rich steam-exploded bark products may have some application in treatment of protein rich effluents and those containing microbial contaminants. [TOP OF PAGE]
- [Phages of halophilic vibrios]. [Russian]. Libinzon, A.E., Us, Z.I., Gal'tseva, G.V., Degtiareva, B.M., Golkovskii, G.M. (1995). Zhurnal Mikrobiologii, Epidemiologii i Immunobiologii 15-18. The morphology and antigenic properties of 34 phages of Vibrio parahaemolyticus and V. alginolyticus strains isolated from Black Sea water, as well as their range of lytic activity and specificity of action, have been studied. Most of these phages have been found to lyze both V. parahaemolyticus and V. alginolyticus strains. In addition, highly specific phages capable of lyzing only V. parahaemolyticus serotype O5:K15, have been detected. The latter fact is a precedent indicating the possibility of search for other typing phages and the development of the scheme for the phage typing of V. parahaemolyticus in future. [TOP OF PAGE]
- Ultrastructural Examination of Virus-like Particles in a Marine Rhizopod (Sarcodina, Protista). Lipscomb, D.L., Riordan, G.P. (1995). Acta Protozoologica 34:35-44. Recent research indicates that bacteriophages are abundant and important for controlling populations in prokaryote microbial communities. The number and role of viruses in eukaryotic microbial communities is less well known. This report demonstrates the presence of polyhedral virus-like particles infecting a free-living, marine rhizopod. The virus-like particle appears to cause cell damage and possibly death. It is able to replicate within the protist and may be able to spread to other members of the population. A survey of the literature indicates that viruses and virus-like particles are present in other protists, perhaps more commonly than usually reported. If viruses are widely dispersed in eukaryote microbial populations, they could contribute significantly to cycling in aquatic food webs and have implications for gene transfer between marine organisms. [TOP OF PAGE]
- Inducible bacteriophages of Actinobacillus actinomycetemcomitans. Loftus, A., Delisle, A.L. (1995). Current Microbiology 30:317-321. Doses of 0.1 to 1.0 mu-g/ml of mitomycin C induced cell lysis of six of eight strains of Actinobacillus actinomycetemcomitans tested. Infectious phages were induced from ATCC strains 43717, 29524, 33384, and 43719; non-plaque- forming, possibly defective phages were induced from ATCC strains 29522 and 29523. No phages were detected in strain FDC 651 or ATCC strain 43718. No correlation between lysogeny and leukotoxin production or serotype of the strains could be established. Gel electrophoresis of phage DNAs indicated that the induced phages were of three types, based on size. By electron microscopy, the phages were found to belong to either morphotype A1 or morphotype B1; no other morphotypes were observed. Curing experiments led to the isolation of nonlysogenic derivatives of two strains, which supported plaque formation by the phages they originally carried. On the basis of our results, lysogeny appears to be widespread in A. actinomycetemcomitans. [TOP OF PAGE]
- Complete nucleotide sequence of the gene encoding bacteriophage E endosialidase: implications for K1E endosialidase structure and function. Long, G.S., Bryant, J.M., Taylor, P.W., Luzio, J.P. (1995). Biochem. J. 309 ( Pt 2):543-550. Bacteriophage E specifically recognizes and infects strains of Escherichia coli which display the alpha-2,8-linked polysialic acid K1 capsule. Bacteriophage E endosialidase, which is thought to be responsible for initial absorption of the phage to the host bacterium, was purified, and the N-terminal amino acid sequences of the polypeptide monomer and cyanogen bromide fragments were determined. Synthetic oligonucleotide probes were designed from the N-terminal amino acid sequences and used to identify restriction fragments of bacteriophage E DNA encoding the endosialidase. The primary nucleotide sequence of the bacteriophage E endosialidase gene contains an open reading frame encoding a 90 kDa polypeptide which is processed to give a mature 74 kDa protein. The native enzyme is probably a trimer of identical 74 kDa subunits. In the bacteriophage E genome the K1E endosialidase open reading frame is preceded by a putative upstream promoter region with homology to a bacteriophage SP6 promoter. A central region of 500 amino acids of the deduced protein sequence of the K1E endosialidase was found to have 84% identity to K1F endosialidase. Both endosialidases contain two copies of a sialidase sequence motif common to many bacterial and viral sialidases. These sequences flank the region of greatest identity between the two endosialidase forms, which suggests that this central domain is involved in binding and hydrolysis of the polysialic acid substrate. [TOP OF PAGE]
- Bacteriophage persistence in the sea environment. Lucena, F., Lasobras, J., Munoz, R., Araujo, R., Jofre, J. (1995). Water Science & Technology 31:195-198. [TOP OF PAGE]
- Simple concentration method for bacteriophages of Bacteroides fragilis in drinking water. Lucena, F., Muniesa, M., Puig, A., Araujo, R., Jofre, J. (1995). Journal of Virological Methods 54:121-130. A membrane of inorganic material with a honeycomb pore structure was used to concentrate phages infecting Bacteroides fragilis from drinking water. Phages were removed from the membrane with 0.25 M glycine buffer pH 9.5. Phages were not inactivated by storage in this buffer neutralized to pH 7.0 for at least 9 days at 4 degrees C. The method allows recovery of around 50% in drinking water. When the turbidity of the water increased, the efficiency of the concentration decreased markedly. The efficiency of concentration was evaluated versus a presence/absence test in 317 water samples with turbidity level below the threshold of drinking water. Results obtained by concentration of 11 provided data which were significantly more informative than the presence/absence tests carried out on 100 ml. A number of additional tests carried out with both somatic and F-specific coliphages indicated that these conclusions can be extended to these groups of bacteriophages. [TOP OF PAGE]
- Minimized virus binding for tests of barrier materials. Lytle, C.D., Routson, L.B. (1995). Appl. Environ. Microbiol. 61:643-649. Viruses are used to test the barrier properties of materials. Binding of virus particles during passage through holes in the material may yield misleading test results. The choices of challenge virus and suspending medium may be important for minimizing confounding effects that might arise from such binding. In this study, different surrogate viruses, as well as different support media, were evaluated to determine optimal test parameters. Two membranes with high-binding properties (nitrocellulose and cationic polysulfone) were used as filters to compare binding activities of different surrogate challenge viruses (MS2, phi X174, T7, PRD1, and phi 6) in different media. The media consisted of buffered saline with surfactants, serum, or culture broth as additives. In addition, elution rates of viruses that bound to the membranes were determined. The results suggest that viruses can bind by hydrophobic and electrostatic interactions, with phi X174 displaying the lowest level of binding by either process. The nonionic detergents Triton X-100 and Tween 80 (0.1%) equally minimized hydrophobic interactions. Neither anionic nor cationic surfactants were as effective at nontoxic levels. Serum was effective at reducing both hydrophobic and electrostatic binding, with 2% being sufficient for eliminating binding under our test conditions. Thus, phi X174 remains the best choice as a surrogate virus to test barrier materials, and Triton X-100 (0.1%) remains a good choice for reducing hydrophobic binding. In addition, binding of viruses by barrier materials is unlikely to prevent passage of blood-borne pathogens. [TOP OF PAGE]
- Damage to Pseudomonas aeruginosa PAO1 bacteriophage F116 DNA by biocides. Maillard, J.-Y., Beggs, T.S., Day, M.J., Hudson, R.A., Russell, A.D. (1995). J. Appl. Bacteriol. 80:291-295. [TOP OF PAGE]
- Effects of biocides on the transduction of Pseudomonas aeruginosa PAO by F116 bacteriophage. Maillard, J.-Y., Beggs, T.S., Day, M.J., Hudson, R.A., Russell, A.D. (1995). Letters in Applied Microbiology 21:215-218. The transduction of Pseudomonas aeruginosa PAO by the F116 bacteriophage was monitored after phage treatment with seven biocides commonly used in disinfection processes. Ethanol (70% and 100%), isopropanol (100%) and phenol (2%) did not affect the ability of the phage to transduce. However, chlorhexidine diacetate (1%), cetylpyridinium chloride (0.05%), glutaraldehyde (2%), peracetic acid (1%) and sodium hypochlorite (0.1%) significantly inhibited F116 transduction. The transduction process was more sensitive to biocides than the phage itself. Inactivation of F116 and inhibition of the transduction process appeared to involve two distinct mechanisms implying that the process depends on cellular target sites not affected by some biocides. [TOP OF PAGE]
- Electron microscopic investigation of the effect of biocides on Pseudomonas aeruginosa PAO bacteriopahges F116. Maillard, J.-Y., Hann, A.C., Beggs, T.S., Day, M.J., Hudson, R.A., Russell, A.D. (1995). J. Med. Microbiol. 42:415-420. [TOP OF PAGE]
- Viral abundance in aquatic systems: a comparison between marine and fresh waters. Maranger, R., Bird, D.F. (1995). Mar. Ecol. Prog. Ser. 121:1-3. [TOP OF PAGE]
- Seasonal variations of virus abundance and viral control of the bacterial production in a backwater system of the Danube River. Mathias, C.B., Kirschner, A.K.T., Velimirov, B. (1995). Appl. Environ. Microbiol. 61:3734-3740. The abundance of virus-like particles in the Kuehwoerte Backwater system of the Danube River covered a range of 1.2 x 10 super(7) to 6.1 x 10 super(7)/ml from 1992 to 1993. Measurements of head diameters for these particles, all of which were presumed to be viruses, led to four defined size classes, ranging from <60 nm to >150 nm. The 60- to <90-nm size class contained the largest fraction of total particles (41%), followed by the 90- to <150-nm size class (33%). The frequency of size classes was not significantly different between the two years. The frequency of bacteria with mature phages ranged from 1 to 4% over the seasons, with mean burst sizes ranging from 17 to 36 phage per host cell. Among the bacterial morphotypes, rods and vibrios were the major host systems for phages, while coccoid and filamentous cells were considered negligible. Counts from transmission electron microscopy and acridine orange direct counts confirmed that rods and vibrios accounted for 85 to 95% of the bacterial population over the seasons. Virus decay experiments showed lower decay rates for temperatures between 5 and 15 degree C (52 to 70% of the virus population remained) relative to 18 and 25 degree C (31 to 51% of the virus remained). Bacterial production measurements, performed at the same time and under the same conditions as decay experiments, allowed us to estimate virus-induced death rates, which ranged from 15.8 to 30.1% over the year, with an average of 20% viral control of the bacterial production. Considering that mature phage particles are visible only in the last phase of the latent period and using a mean conversion factor of 5.4 from the literature, based on descriptions of various phage host systems to relate the percentage of visibly infected cells to the total percentage of the bacterial community that is phage infected, we estimate that some 5.4 to 21.6% of the bacterial population is infected with viruses. This would imply that virus-induced death rates of bacteria range from 10.8 to 43.2%. The data on virus-induced bacterial mortality obtained by both the viral decay method and the determination of the frequency of infected cells are compared and discussed. [TOP OF PAGE]
- A powerful bacterial world. Mathieu, L.G., Sonea, S. (1995). Endeavour 19:112-117. Bacteria (prokaryotes) were the sole form of life on earth for some two billion years--roughly half its history. During this time they evolved into a giant, global superorganism and developed a remarkable mechanism for the creation and exchange of genetic material. Apart from its intrinsic interest, this has practical significance, for example in the development of multiple resistance to antibiotics of pathogenic bacteria such as those of tuberculosis. Eukaryotes, with nucleated cells, may have developed from a permanent symbiosis of three or more prokaryotes. [References: 17]. [TOP OF PAGE]
- Viruses of eukaryotic freshwater and marine algae. Meints, R.H., Graves, M.V., Henry, E.C. (1995). p. ???-??? In Koltin, Y., Leibowitz, M., and Rubio, V. (eds.), Viruses of Fungi and Lower Eukaryotes. [TOP OF PAGE]
- Presence of lysogenic phage in the outbreak strains of Vibrio cholerae O139. Mitra, S.N., Kar, S., Ghosh, R.K., Pajni, S., Ghosh, A. (1995). J. Med. Microbiol. 42:399-403. Four outbreak strains of Vibrio cholerae O139 from endemic areas of India and Bangladesh were found to carry lysogenic phage(s). All of these phage(s) produced turbid plaques characteristic of lysogeny on V. cholerae MAK 757 (El Tor, Ogawa) cells as well as on their VcA-1 lysogens but were unable to infect V. cholerae 154 (classical) cells, the universal host for all classical phages. Colonies in the turbid plaques were O139 lysogens and these developed an auxotrophic requirement, mainly for purines suggesting the integration of the prophage into the host chromosome. The immunity profile of the O139 phage(s) was similar to that of phage alpha but differed in the sensitivity of the phage lysogen of V. cholerae MAK 757 to subsequent infection by phage beta. [TOP OF PAGE]
- Cloning and sequencing of LlaDCHI [corrected] restriction/modification genes from Lactococcus lactis and relatedness of this system to the Streptococcus pneumoniae DpnII system [published erratum appears in Appl Environ Microbiol 1995 Sep;61(9):3514]. Moineau, S., Walker, S.A., Vedamuthu, E.R., Vandenbergh, P.A. (1995). Appl. Environ. Microbiol. 61:2193-2202. The natural 7.8-kb plasmid pSRQ700 was isolated from Lactococcus lactis subsp. cremoris DCH-4. It encodes a restriction/modification system named LlaDCHI [corrected]. When introduced into a phage-sensitive L. lactis strain, pSRQ700 confers strong phage resistance against the three most common lactococcal phage species, namely, 936, c2, and P335. The LlaDCHI [corrected] endonuclease was purified and found to cleave the palindromic sequence 5'-GATC-3'. It is an isoschizomer of Streptococcus pneumoniae DpnII. The plasmid pSRQ700 was mapped, and the genetic organization of LlaDCHI [corrected] was localized. Cloning and sequencing of the entire LlaDCHI [corrected] system allowed the identification of three open reading frames. The three genes (llaIIA, llaIIB, and llaIIC) overlapped and are under one putative promoter. A putative terminator was found at the end of llaIIC. The genes llaIIA and llaIIB coded for m6A methyltransferases, and llaIIC coded for an endonuclease. The LlaDCHI [corrected] system shares strong genetic similarities with the DpnII system. The deduced amino acid sequence of M.LlaIIA was 75% identical with that of M.DpnII, whereas M.LlaIIB was 88% identical with M.DpnA. However, R.LlalII shared only 31% identity with R.DpnII. [TOP OF PAGE]
- Expression of a Lactococcus lactis phage resistance mechanism by Streptococcus thermophilus. Moineau, S., Walker, S.A., Holler, B.J., Vedamuthu, E.R., Vandenbergh, P.A. (1995). Appl. Environ. Microbiol. 61:2461-2466. The 7.8-kb lactococcal plasmid pSRQ700 encodes the LlaII restriction/modification system which recognizes and cleaves the sequence 3'-GATC-5'. When the plasmid pSRQ700 is introduced into a phage-sensitive Lactococcus lactis strain, strong phage resistance is conferred by the LlaII system. In this report, we show that pSRQ700 cannot replicate in Streptococcus thermophilus. However, if cloned into the vector pNZ123, the native LlaII system is expressed and strong phage resistance is conferred to various industrial S. thermophilus strains. Resistance against phages isolated from yogurt and mozzarella wheys was observed. To our knowledge, this is the first report of increased phage resistance in S. thermophilus. [TOP OF PAGE]
- Prophage distribution in coryneform bacteria. Moreau, S., Leret, V., Le, M., Varangot, H., Ayache, M., Bonnassie, S., Blanco, C., Trautwetter, A. (1995). Res. Microbiol. 146:493-505. Four temperate bacteriophages of corynebacteria were isolated after UV induction. Phages phi 304L and phi 304S were both induced from Corynebacterium glutamicum ATCC 13058, ATCC 21488, ATCC 21649 and ATCC 21650 strains, and have no known sensitive host. Phages phi 15 and phi 16 were both induced from ATCC 14020 and ATCC 21792. Phage phi 15 formed turbid plaques on Corynebacterium sp. ATCC 21857 and on C. glutamicum ATCC 13058, ATCC 21488, ATCC 21649 and ATCC 21650. Phage phi 16 produced turbid plaques only on C. glutamicum ATCC 21792 cured of prophage phi 16. All these phages belong to the Siphoviridae family. Their genomes consist of a double-stranded DNA with cohesive ends and share no homology with each other. Prophages phi 16, phi 304L and phi 304S were integrated into their respective host chromosomes, whereas prophage phi 15 seemed to persist free in the cell. Cross-hybridizations between phage DNAs and total cellular DNA obtained from 20 strains belonging to the genera Corynebacterium and Brevibacterium did not show the presence of these prophages in strains other than their respective hosts. [TOP OF PAGE]
- Sewage dispersion in an estuary with distinct EBB and flood channels. Morgan, N., Munro, D., Mollowney, B.M., Linwood, P. (1995). Environment International 21:123-130. As a result of a combination of the European Communities (EC) Bathing Water and urban Waste Water Treatment Directives, the option of discharging biological treated effluent into estuaries and shallow coastal waters through short outfalls is being increasingly considered. This has meant that sewage disposal models are now required to resolve water movement in inshore waters. As part of an environmental assessment into the options for the treatment and disposal of sewage from Felixstowe, Harwich and Dovercourt, Anglian Water commissioned WRc to produce a bacterial dispersion model of the area. It was necessary to quantify the complex flows suspected in harwich Harbour and to be able to simulate their impact on effluent dispersion. This paper describes the development and application of this model. A detailed 2D hydrodynamic model was calibrated against Vessel Mounted Acoustic Doppler Current Profiler data gathered in the area. A bacterial dispersion model driven by this hydrodynamic model was validated using bacteriophage tracer releases. The model has been applied to demonstrate that the treatment options under consideration will comply fully with the Bathing Water Directive and are constant with the Anglian Water Environmental Policy. [TOP OF PAGE]
- Biocontrol of bacterial blotch of the cultivated mushroom with lytic phages: Some practical considerations. Munsch, P., Olivier, J.M. (1995). pp. 595-602. In In Elliott, T.J. (ed.), Science and Cultivation of Edible Fungi, Vol. II: Proceedings of the 14th International Congress. [TOP OF PAGE]
- Virus taxonomy. Classification and nomenclature of viruses. Sixth report of the International Committee on Taxonomy of Viruses. Murphy, F.A., Fauquet, C.M., Bishop, D.H.L., Ghabrial, S.A., Jarvis, A.W., Martelli, G.P., Mayo, M.A., Summers, M.D. (1995). Archives of Virology Supplent 10:51-54. [TOP OF PAGE]
- Phytoplankton exudation: Exploitation of the microbial loop as a defense against algal viruses. Murray, A.G. (1995). J. Plankton Res. 17:1079-1094. [TOP OF PAGE]
- Virus-like particles in unicellular apochlorotic microorganisms in the coastal water of Japan. Nagasaki, K., Ando, M., Imai, I., Itakura, S., Ishida, Y. (1995). Fish. Sci. 61:235-239. [TOP OF PAGE]
- Removal of hepatitis-A virus (HAV), poliovirus and MS2 coliphage by coagulation and high-rate filtration. Nasser, A., Weinberg, D., Dinoor, N., Fattal, B., Adin, A. (1995). Water Science & Technology 31:63-68. [TOP OF PAGE]
- Plasmid profiles and stability of industrial strains of lactococci. Nechaeva, A.A., Kalinina, N.A., Sukhodolets, V.V. (1995). Genetika 31:1210-1217. Industrial lactococci strains, usually cultivated on agar with hydrolyzed milk, are characterized by an increased instability with respect to their ability to utilize lactose on enriched M21 medium. Plasmid profiles of 14 industrial strains of Lactococcus lactis subs. km and of a large number of segregants phenotypically differing in sugar-fermenting ability and phage sensitivity were examined. Four out of 14 strains segregated Lac- Gal- clones, i.e., simultaneously lost the ability to utilize lactose and galactose. All phage-sensitive segregants retained systems of DNA restriction and modification. Segregants sensitive to the phage lethal effect were found. These segregants possibly retained the defense mechanism against phages manifested as abortive infection. In the majority of Lac- segregants, large plasmids of 40 to 55 kb were lost, although changes in plasmid profiles of many Lac- segregants were not detected. [TOP OF PAGE]
- Extreme fitness differences in mammalian and insect hosts after continuous replication of vesicular stomatitis-virus in sandfly cells. Novella, I.S., Clarke, D.K., Quer, J., Duarte, E.A., Lee, C.H., Weaver, S.C., Elena, S.F., Moya, A., Domingo, E., Holland, J.J. (1995). J. Virol. 69:6805-6809. Continuous, persistent replication of a wild-type strain of vesicular stomatitis virus in cultured sandfly cells for 10 months profoundly decreased virus replicative fitness in mammalian cells and greatly increased fitness in sandfly cells. After persistent infection of sandfly cells, fitness was over 2,000,000-fold greater than that in mammalian cells, indicating extreme selective differences in the environmental conditions provided by insect and mammalian cells. The sandfly-adapted virus also showed extremely low fitness in mouse brain cells (comparable to that in mammalian cell cultures). It also showed an attenuated phenotype, requiring a nearly millionfold higher intracranial dose than that of its parent clone to kill mice. A single passage of this adapted virus in BHK-21 cells at 37 degrees C restored fitness to near neutrality and also restored mouse neurovirulence. These results clearly illustrate the enormous capacity of RNA viruses to adapt to changing selective environments. [TOP OF PAGE]
- Size of genetic bottlenecks leading to virus fitness loss is determined by mean initial population fitness. Novella, I.S., Elena, S.F., Moya, A., Domingo, E., Holland, J.J. (1995). J. Virol. 69:2869-2872. Genetic bottlenecks are important events in the genetic diversification of organisms and colonization of new ecological niches. Repeated bottlenecking of RNA viruses often leads to fitness losses due to the operation of Muller's ratchet. Herein we use vesicular stomatitis virus to determine the transmission population size which leads to fitness decreases of virus populations. Remarkably, the effective size of a genetic bottleneck associated with fitness loss is greater when the fitness of the parental population increases. For example, for starting virus populations with low fitness, population transfers of five-clone-to-five-clone passages resulted in a fitness increase. However, when a parental population with high fitness was transferred, 30-clone-to-30-clone passages were required simply to maintain fitness values. [TOP OF PAGE]
- Exponential increases of RNA virus fitness during large population transmissions. Novella, I.S., Duarte, E.A., Elena, S.F., Moya, A., Domingo, E., Holland, J.J. (1995). Proc. Natl. Acad. Sci. USA 92:5841-5844. The great adaptability shown by RNA viruses is a consequence of their high mutation rates. Here we investigate the kinetics of virus fitness gains during repeated transfers of large virus populations in cell culture. Results always show that fitness increases exponentially. Low fitness clones exhibit regular increases observed as biphasic periods of exponential evolutionary improvement, while neutral clones show monophasic kinetics. These results are significant for RNA virus epidemiology, optimal handling of attenuated live virus vaccines, and routine laboratory procedures. [TOP OF PAGE]
- Halophage HF2: genome organisation and replication strategy. Nuttall, S.D., Dyall-Smith, M.L. (1995). J. Virol. 69:2322-2327. Halophage HF2 is a lytic, broad-host-range bacteriophage of the extremely halophilic domain Archaea. It has a 79.7-kb double-stranded DNA genome which is linear, contains no modified nucleotides, and is not susceptible to cleavage by many type II restriction endonucleases. This insensitivity is attributed to selection against palindromic restriction sites, a commonly observed feature of broad-host-range phages. Interestingly, enzymes that did cut the genome recognized AT-rich sites, and five such enzymes, DraI, AseI, HpaI, HindIII,
and SspI, were used to construct a physical map of the genome. Southern hybridization experiments used to order fragments on the map indicated homologies between the phage termini, and subsequent sequence analysis showed that HF2 possessed 306-bp direct terminal repeats. The presence of such repeats suggested replication through concatameric intermediates, and this was confirmed by analysis of the state of the phage genome in infected cells. This is a replication strategy adopted by many well-studied bacterial phages, for example T3 and T7. Other similarities between the terminal repeats of T3 or T7 and HF2 include a putative nick site at the repeat border and a series of short imperfect repeats. These observations suggest a long evolutionary history for concatamer-based strategies of phage replication, possibly predating the divergence of Archaea/Eucarya and Bacteria, or alternatively, indicate possible lateral transfer of phage genes or modules between the domains Archaea and Bacteria. [TOP OF PAGE]
- Restriction-modification systems in Lactococcus lactis. Nyengaard, N., Vogensen, F.K., Josephsen, J. (1995). Gene 157:13-18. Several restriction-modification (R-M) systems have been identified in Lactococcus lactis. Most of the systems have been plasmid encoded and function as phage-resistance mechanisms. At least five different type-II R-M systems, LlaAI, LlaBI, LlaCI, LlaDI and LlaEI, were identified in isolates from a mixed Cheddar starter culture. LlaAI and LlaBI recognized the DNA sequences 5'- decreases GATC-3' and 5'-C decreases TRYAG-3', respectively. The genes coding for the LlaAI and LlaBI R-M systems have been cloned and sequenced. The LlaAI R-M system had two genes coding for methyltransferases (MTases) and one gene coding for a restriction endonuclease (ENase). The MTases showed high homology to the MTases from DpnII. The LlaBI R-M system had one gene coding for a MTase and one gene coding for an ENase. [TOP OF PAGE]
- In vivo restriction by LlaI is encoded by three genes, arranged in an operon with llaIM, on the conjugative Lactococcus plasmid pTR2030. O'Sullivan, D.J., Zagula, K., Klaenhammer, T.R. (1995). J. Bacteriol. 177:134-143. The LlaI restriction and modification (R/M) system is encoded on pTR2030, a 46.2-kb conjugative plasmid from Lactococcus lactis. The llaI methylase gene, sequenced previously, encodes a functional type IIS methylase and is located approximately 5 kb upstream from the abiA gene, encoding abortive phage resistance. In this study, the sequence of the region between llaIM and abiA was determined and revealed four consecutive open reading frames (ORFs). Northern (RNA) analysis showed that the four ORFs were part of a 7-kb operon with llaIM and the downstream abiA gene on a separate transcriptional unit. The deduced protein sequence of ORF2 revealed a P-loop consensus motif for ATP/GTP-binding sites and a three-part consensus motif for GTP-binding proteins. Data bank searches with the deduced protein sequences for all four ORFs revealed no homology except for ORF2 with MerB, in three regions that coincided with the GTP-binding motifs in both proteins. To phenotypically analyze the llaI operon, a 9.0-kb fragment was cloned into a high-copy-number lactococcal shuttle vector, pTRKH2. The resulting construct, pTRK370, exhibited a significantly higher level of in vivo restriction and modification in L. lactis NCK203 than the low-copy-number parental plasmid, pTR2030. A combination of deletion constructions and frameshift mutations indicated that the first three ORFs were involved in LlaI restriction, and they were therefore designated llaI.1, llaI.2, and llaI.3. Mutating llaI.1 completely abolished restriction, while disrupting llaI.2 or llaI.3 allowed an inefficient restriction of phage DNA to occur, manifested primarily by a variable plaque phenotype. ORF4 had no discernible effect on in vivo restriction. A frameshift mutation in llaIM proved lethal to L. lactis NCK203, implying that the restriction component was active without the modification subunit. These results suggested that the LlaI R/M system is unlike any other R/M system studied to date and has diverged from the type IIS class of restriction enzymes by acquiring some characteristics reminiscent of type I enzymes. [TOP OF PAGE]
- Bacterial genetic exchange in nature. Ogunseitan, O.A. (1995). Science Progress 78:183-204. [TOP OF PAGE]
- Nucleotide sequence of a single-stranded RNA phage from Pseudomonas aeruginosa: Kinship to coliphages and conservation of regulatory RNA structures. Olsthoorn, R.C.L., Garde, G., Dayhuff, T., Atkins, J.F., van Duin, J. (1995). Virology 206:611-625. We report the complete nucleotide sequence of the single- stranded RNA phage PP7 from Pseudomonas aeruginosa. There are three open reading frames which code for apparent protein homologues of the single-stranded RNA coliphages, i.e., maturation protein, coat protein, and replicase. A fourth overlapping reading frame exists that probably encodes a lysis protein, similar to what has been found in the group A coliphages such as MS2. The genetic map of PP7 is colinear with group A coliphages and we accordingly classify the phage as a levivirus. There is, generally speaking, no significant nucleotide sequence identity between PP7 and the coliphages except for a few regions where homologous parts of proteins are encoded, most notable in the replicase gene. In these regions the nucleotide sequence similarity between PP7 and MS2 is no greater than between PP7 and the group B coliphages such as Q-beta. Surprisingly, Q-beta and MS2 are no closer to each other than they are to PP7. Several regulatory RNA secondary structure features that are present in the coliphages were identified also in PP7 RNA although the sequences involved cannot be aligned. Among these are the coat protein binding helix at the start of the replicase gene, structures at the 5' and 3' terminus of the RNA, a replicase binding site, and the structure of the coat protein cistron start. Some of these features resemble MS2 type coliphages but others the Q-beta type. These findings suggest that PP7 is related to the coliphages but branched off before the coliphages diverged into separate groups. [TOP OF PAGE]
- Detection of spring viremia of carp virus by hybridization with biotinylated DNA probes. Oreshkova, S.F., Tikunova, N.V., Shchelkunov, I.S., Ilyichev, A.A. (1995). Veterinary Research [VET. RES. ] 26:533-537. Spring viremia of carp virus (SVCV) is a fish rhabdovirus that causes a disease which remains largely untreatable. It is responsible for heavy economic losses in the pond fisheries of Russia. Typically, the detection of viral diseases in fish is based on the isolation of the virus in a sensitive cell culture and confirmation of its presence by serum neutralization. Since these techniques are rather time-consuming and expensive, an important priority in SVCV research has been the development of more rapid and sensitive diagnostic methods. In order to obtain a specific and sensitive hybridization test for SVCV we constructed DNA probes using the technique of reverse transcription, amplification by PCR and cDNA cloning in plasmid and phage vectors. The sequence of the cDNA coding for the matrix protein of SVCV is known (Kiuchi and Roy, 1984) and it was shown that this virus may be related (according to the structure of the 3' end of the viral RNA) to the vesiculovirus. The cDNA to genome RNA of SVCV was synthesized with the aid of both random and primer 1. Primer 1 (5'CATGTCTACTCTAAGAAAGC) and primer 2 (5'ACCGAATCGATGAGGCACAT) were used for PCR. [TOP OF PAGE]
- PHAGE-MEDIATED DETECTION OF STAPHYLOCOCCUS AUREUS AND ESCHERICHIA COLI O157:H7 USING BIOLUMINESCENCE. PAGOTTO, F.J. (1995). UNIVERSITY OF GUELPH (CANADA). Viable bacteria may be detected in biological samples by exposing the sample to transducing particles having a known host range. These transducing particles carry a reporter gene which alters the phenotype of the bacteria upon infection to a readily detectable one. The goal of this investigation was to develop a method where detection in conjunction with antibiotic testing of specific bacteria could be accomplished rapidly. Bacteriophages specific for Staphylococcus aureus and Escherichia coli O157:H7 were genetically modified to carry the genes encoding for bioluminescence. These transducing particles were able to detect 10$/sp6$CFU/ml and 10$/sp7$CFU/ml of S. aureus, and E. coli O157:H7, respectively. The modified phages were able to detect the bacteria even in the presence of competing bacteria. Once the bacteria were detected, antibiotic susceptibility of E. coli O157:H7 was done in situ, using light emission as a measure of antibiotic efficacy against the biochemistry of the bacteria. In less than two hours, information was acquired as to which antibiotic would be most suitable for therapy. [TOP OF PAGE]
- Lipopolysaccharide recovery restores susceptibility levels towards beta-lactams in Serratia marcescens. Palomar, J., Puig, M., Montilla, R., Loren, J.G., Vinas, M. (1995). Microbios 82:21-26. O-side chain-defective spontaneous mutants of Serratia marcescens, selected by phage resistance, showed lower MICs against various beta-lactams than did their parental strains. The recovery of their ability to produce O-antigen restored the original MIC values, as well as phage susceptibility. The permeability coefficients of wild-type, O- mutants, and revertants, demonstrated that O-antigen modifies the permeability of antibiotics in S. marcescens. [TOP OF PAGE]
- Spread of bacterial resistance to antibiotics through the aquatic environment [Greek]. Papapetropoulou, M. (1995). Deltion Ellenikes Mikrobiologikes Etaireias 40:473-479. The significant increase of the number of bacteria resistant to multiple antibiotics is attributed to the irrational use of antimicrobials and the increase in dumping of wastewater. As a result, the aquatic environment provides a source and a reservoir of resistant genes as well as a medium for their spread. The three well established mechanisms of gene transfer, i.e. conjugation, transduction and transformation are well believed to occurring the aquatic environment The ways of gene transfer in the oligotrophic aquatic environment are discussed. [TOP OF PAGE]
- Isolation of Dermatophilus congolensis phage from the 'lumpy wool' of sheep in Western Australia. Patten, K.M., Kurtboke, D.I., Lindsay, D.R. (1995). Letters in Applied Microbiology 20:199-203. A lytic phage with species-specific activity was isolated from wool samples infected with the actinomycete Dermatophilus congolensis, the agent of 'lumpy wool', collected from properties in Western Australia. The physiochemical properties, plaque morphology, host range and particle morphology of the phage isolated were characterized. The isolated phage reduced the cell numbers of Dermatophilus congolensis on infected wool samples in vitro. It may therefore have potential as a biocontrol agent of dermatophilosis. [TOP OF PAGE]
- Occurrence of fecal indicator bacteria in surface waters and the subsurface aquifer in Key Largo, Florida. Paul, J.H., Rose, J.B., Kellogg, C., Shinn, E.A. (1995). Appl. Environ. Microbiol. 61:2235-2241. Sewage waste disposal facilities in the Florida Keys include septic tanks and individual package plants in place of municipal collection facilities in most locations. In Key Largo, both facilities discharge into the extremely porous Key Largo limestone. To determine whether there was potential contamination of the subsurface aquifer and nearby coastal surface waters by such waste disposal practices, we examined the presence of microbial indicators commonly found in sewage (fecal coliforms, Clostridium perfringens, and enterococci) and aquatic microbial parameters (viral direct counts, bacterial direct counts, chlorophyll a, and marine vibriophage) in injection well effluent, monitoring wells that followed a transect from onshore to offshore, and surface waters above these wells in two separate locations in Key Largo in August 1993 and March 1994. Effluent and waters from onshore shallow monitoring wells (1.8- to 3.7-m depth) contained two or all three of the fecal indicators in all three samples taken, whereas deeper wells (10.7- to 12.2-m depth) at these same sites contained few or none. The presence of fecal indicators was found in two of five nearshore wells (i.e., those that were < or = 1.8 miles [< or = 2.9 km] from shore), whereas offshore wells (> or = 2.1 to 5.7 miles [< or = 3.4 to 9.2 km] from shore) showed little sign of contamination. Indicators were also found in surface waters in a canal in Key Largo and in offshore surface waters in March but not in August. Collectively, these results suggest that fecal contamination of the shallow onshore aquifer, parts of the nearshore aquifer, and certain surface waters has occurred.(ABSTRACT TRUNCATED AT 250 WORDS). [TOP OF PAGE]
- Viral tracer studies indicate contamination of marine waters by sewage disposal practices in Key Largo, Florida. Paul, J.H., Rose, J.B., Brown, J., Shinn, E.A., Miller, S., Farrah, S.R. (1995). Appl. Environ. Microbiol. 61:2230-2234. Domestic wastewater disposal practices in the Florida Keys are primarily limited to on-site disposal systems such as septic tanks, injection wells, and illegal cesspits. Poorly treated sewage is thus released into the highly porous subsurface Key Largo limestone matrix. To investigate the fate and transport of sewage in the subsurface environment and the potential for contamination of marine surface waters, we employed bacteriophages as tracers in a domestic septic system and a simulated injection well in Key Largo, Florida. Transport of bacteriophage PHI-HSIC-1 from the septic tank to adjacent surface canal waters and outstanding marine waters occurred in as little as 11 and 23 h, respectively. Transport of the Salmonella phage PRD1 from the simulated injection well to a canal adjacent to the injection site occurred in 11.2 h. Estimated rates of migration of viral tracers ranged from 0.57 to 24.2 m/h, over 500- fold greater than flow rates measured previously by subsurface flow meters in similar environments. These results suggest that current on-site disposal practices can lead to contamination of the subsurface and surface marine waters in the Keys. [TOP OF PAGE]
- Ultra-morphology of coliphages isolated from water. Pedroso, D.M.M., Martins, M.T. (1995). Water Res. 29:1199-1202. Using the ARCAT technique for coliphage detection, variations in different plaques have been noted. Investigation on the associated phage ultra-morphology for 45 plaques isolated in different kinds of water in Sao Paulo State, Brazil indicated the phages involved belonged to three families: Myoviridae, Podoviridae and Siphoviridae. There were no apparent relationship between coliphage family and specific plaque morphology. Escherichia coli strain ATCC 13.706 detected a broad spectrum of coliphage in water. A high diversity of coliphages were detected in the water analysed. [TOP OF PAGE]
- Isolation of bacteriophage infectious for Vibrio vulnificus. Pelon, W., Siebeling, R.J., Simonson, J., Luftig, R.B. (1995). Current Microbiology 30:331-336. Nine phage isolates infectious for Vibrio vulnificus and falling into four morphological groups were isolated from estuarine waters collected in Louisiana. Of the 60 V. vulnificus strains tested, 87% were susceptible to one or more of the isolates. With the exception of V. fluvialis, Vibrio species other than vulnificus were resistant to infection. A spectrum of enteric bacterial strains were similarly resistant. Susceptibility differences were seen between opaque (virulent) V. vulnificus strains and those with translucent (nonvirulent) colony types, with the former being more susceptible. Susceptibility patterns to infection by the nine phage isolates among the V. vulnificus test strains suggest that the latter may fall into several groups. Other aspects relating to the phage isolates are presented. [TOP OF PAGE]
- Phage T4-coded Stp: double-edged effector of coupled DNA and tRNA-restriction systems. Penner, M., Morad, I., Snyder, L., Kaufmann, G. (1995). J. Mol. Biol. 249:857-869. The optional Escherichia coli prr locus encodes two physically associated restriction systems: the type IC DNA restriction-modification enzyme EcoprrI and the tRNA(Lys)-specific anticodon nuclease, specified by the PrrC polypeptide. Anticodon nuclease is kept latent as a result of this interaction. The activation of anticodon nuclease, upon infection by phage T4, may cause depletion of tRNA(Lys) and, consequently, abolition of T4 protein synthesis. However, this effect is counteracted by the repair of tRNA(Lys) in consecutive reactions catalysed by the phage enzymes polynucleotide kinase and RNA ligase. Stp, a short polypeptide encoded by phage T4, has been implicated with activation of the anticodon nuclease. Here we confirm this notion and also demonstrate a second function of Stp: inhibition of EcoprrI restriction. Both effects depend, in general, on the same residues within the N-proximal 18 residue region of Stp. We propose that Stp alters the conformation of EcoprrI and, consequently, of PrrC, allowing activation of the latent anticodon nuclease. Presumably, Stp evolved to offset a DNA restriction system of the host cell but was turned, eventually, against the phage as an activator of the appended tRNA restriction enzyme. [TOP OF PAGE]
- [The efficacy of bacteriophage preparations in treating inflammatory urologic diseases]. [Russian]. Perepanova, T.S., Darbeeva, O.S., Kotliarova, G.A., Kondrat'eva, E.M., Maiskaia, L.M., Malysheva, V.F., Baiguzina, F.A., Grishkova, N.V. (1995). Urologiia i Nefrologiia 14-17. Urinary infection is the most commonly encountered hospital infection. Antibacterial therapy promotes selection and dissemination of polyresistant microorganism strains, development of intestinal dysbacteriosis, reduction of intestinal contamination resistance. Clinical and bacteriological efficacy of urinary infection treatment with bacteriophage preparations (pyocyanic, proteus, staphylococcal, coliphage, combined pyobacteriophage) was studied. Sensitivity of the infective agent phage isolated from urological patients was tested before treatment. The preparations were adapted to recently isolated agents from urological patients to raise phage sensitivity of the strains. A total of 293 strains were studied. Phage sensitivity made up 68.9%. Bacteriophage preparations were used both locally and orally in 46 patients with acute and chronic urogenital inflammation. Bacteriological efficacy amounted to 84%, clinical one to 92%. It is inferred that phagotherapy is effective and safe therapeutic modality in the treatment of urinary infection in monotherapy and in combination with antibiotics. [TOP OF PAGE]
- In situ inactivation of animal viruses and a coliphage in nonaerated liquid and semiliquid animal wastes. Pesaro, F., Sorg, I., Metzler, A. (1995). Appl. Environ. Microbiol. 61:92-97. The persistence of five animal viruses, representing picorna-, rota-, parvo-, adeno-, and herpesviruses, and the coliphage f2 was determined in the field by exposing the viruses to different animal wastes and by adopting an established filter sandwich technique. This technique allows us to copy the natural state of viruses in the environment, where adsorption onto or incorporation into suspended solids may prolong virus survival. Using filter sandwiches either equipped with porous (15 nm in diameter) or poreless polycarbonate (PC) membranes, it was possible to differentiate between overall virus inactivation and the effect of virucidal agents that act through poreless PC membranes. Depending on ambient temperature, pH, and type of animal waste, values for time, in days, required for a 90% reduction of virus titer varied widely, ranging from less than 1 week for herpesvirus to more than 6 months for rotavirus. Virus inactivation progressed substantially faster in liquid cattle manure, a mixture of urine and water (pH gt 8.0), than in semiliquid wastes that consisted of mixtures of feces, urine, water, and bedding materials (pH lt 8.0). Hitherto unidentified virucidal agents that permeate poreless PC membranes contributed substantially to the overall inactivation. On the other hand, substances that protect rotavirus and possibly other viruses from inactivation may be present in animal wastes. Together, the study showed that viruses contained in manure may persist for prolonged periods of time if stored under nonaerated conditions. At times of land application, this may lead to environmental contamination with pathogens. [TOP OF PAGE]
- Bacteriophage typing. Pitt, T.L., Gaston, M.A. (1995). Methods in Molecular Biology 46:15-26. [TOP OF PAGE]
- ??? Poletika, N.N., Jury, W.A., Yates, M.V. (1995). Water Resourses Research 31:801-810. [TOP OF PAGE]
- Transport of bromide, simazine, and MS-2 coliphage in a lysimeter containing undisturbed, unsaturated soil. Poletika, N.N., Jury, W.A., Yates, M.V. (1995). p.801-810. Washington, DC : American Geophysical Union, Apr. 1995, [TOP OF PAGE]
- The erythrocytes and lysate of erythrocytes might mitigate harmful effect of UVC-light on mammalian cells or bacteriophage lambda. Poljak Blazi, M., Stambolija, N., Petranovic, M. (1995). Periodicum Biologorum 97:35-40. Background and purpose: Harmful effect of UV light involves cell killing mutagenesis and neoplastic transformation of exposed cells. Mammalian cells are not equally sensitive to UVC light. The loss of viability is the end point of cellular dysfunction, however, UV irradiation may affect cell function before its perish, UVA/B light penetrates dermal blood vessels and the lymphatics and causes erythrocyte lysis and affects the viability and function of circulating lymphocytes. We examined the mechanism of the protective role of erythrocytes and lysed erythrocytes on mononuclear cells lysis and on their colony forming ability after UVC irradiation. The bacteriophage lambda was also used for evolution of the protective role of RBC lysate from the UVC light. Material and methods: Peripheral blood diluted in Hank's solution (2 times 10-8 erythrocytes per mL) or a mixture of 2 times 10-6 bone marrow cells and 2 times 10-8 erythrocytes, were exposed to UVC light spread in thin layers (2 mm) in glass Petri dishes. Hemolysis was determined measuring the haemoglobin in the supernatants immediately after the UCV irradiation. Smears of the sediment were stained and differential counts were determined. The bone marrow cells were propagated in vivo for determination of the colony forming ability. Phage viability was measured by plaque forming ability on indicator bacterial strain E. coli. Results: High fluences of UVC caused hemolysis of the erythrocytes and reduced the number of nucleated blood cells to 6096. The erythrocytes, as well as the substance(s) from lysed erythrocytes (predominantly haemoglobin), could protect the bone marrow stem cells from UVC fluences as high as 16 kJ/m-2. The phage survival is about 3700 times higher if the phages were irradiated in supernatant of hemolyzed erythrocytes. The phage survival was even higher (about 6300 times) if the supernatant of hemolyzed erythrocytes was previously irradiated (with 4 kJ/m-2). Conclusions: 1. High fluence of the UCV/light (10 kJ/m-2) lysed erythrocytes completely. At the same conditions only 4096 of nucleated cells of peripheral blood were lysed. 2. The erythrocytes, as well as the substance(s) from lysed erythrocytes protect the bone marrow stem cells from UVC fluences as high as 16 kJ/m-2. For comparison, only 0.08 kJ/m-2 abolished the colony formation of stem cell completely. 3. The mechanism of the protection of bone marrow cells and phage lambda from the UVC light remains unclear but results suggest that it is due to the presence of substances from lysed erythrocytes, and not only due to the erythrocytes themselves. [TOP OF PAGE]
- [The DNA damage by photodynamic effects of hematoporphyrin derivatives (HPD)]. [Chinese]. Qi, Z., Qin, J., Zhao, X., Yan, J., Li, Z. (1995). Chung-Kuo i Hsueh Ko Hsueh Yuan Hsueh Pao Acta Academiae Medicinae Sinicae 17:139-144. Photodynamic effects of HPD has been used for cancer therapy (PDT) successfuly. The biological mechanism of the PDT was studied by using DNA as a target in this work. After treatment of phage M13 DNA with HPD + light the molecule of the DNA kept intact in TE buffer. But the smear bands by puting DNA in 0.1 mol/L NaOH at 90 degrees C and separating with electrophoresis denoted the degradation of DNA at the alkali-labile sites of phosphodiester bond in which the groups of the bases were photooxydized. The primer extension experiment showed the aggregation of DNA template by photooxydation. The DNA sequencing results showed that some of the wrong sequences appeared both at the site of A,G,C,T bases. The mouse Ehrlich ascetes carcinoma cell DNA was treated as above then degraded by Bgl II and BamH I respectively. It was found that the restriction fragments became larger than the controls. It also meant the alteration of the bases of DNA by the photooxydation. So the four bases of A,G,C,T of DNA were altered by photodynamic effects of HPD. [TOP OF PAGE]
- Effect of advanced oxidation processes on inactivation of coliphages. Rajala-Mustonen, R.L., Heinonen-Tanski, H. (1995). Water Science and Technology 31:131-134. [TOP OF PAGE]
- DNA UVB dosimeters. Regan, J.D., Yoshida, H. (1995). Journal of Photochemistry and Photobiology B Biology 31:57-61. DNA can be used to establish and monitor solar UVB dose. Since the principal molecular site of UVB damage in living organisms is DNA, it is logical to quantitate biologically effective solar UVB in DNA dosimeters. In addition to their particular sensitivity to UVB, DNA dosimeters have the advantages of a 2-pi geometry for collecting diffuse UVB radiation from all vectors, low cost, small size and portability, and no moving parts. Both molecular (cyclobutane pyrimidine dimers) and biological (bacteriophage plaques) dosimeters can be quantitated as endpoints to yield the total dose. DNA dosimeters integrate the absorbed energy of all UVB wavelengths (290-320 nm), are highly sensitive to the differential biological effectiveness of these wavelengths, and also integrate over time in hours, days or weeks of exposure. Our experiments have focused on the demonstration of DNA solar dosimeters in the ocean at various depths, the application of the dosimeters to the terrestrial monitoring of solar UVB under various conditions, and the development of a mini-dosimeter which uses nanograms of DNA and is assayed by polymerase chain reaction. [TOP OF PAGE]
- Characterization of Vibrio cholerae bacteriophage K139 and use of a novel mini-transposon to identify a phage-encoded virulence factor. Reidl, J., Mekalanos, J.J. (1995). Molecular Microbiology 18:685-701. Temperate bacteriophage K139 was isolated from a Vibrio cholerae O139 isolate and characterized in this study. The phage genome consists of a 35 kbp, double-stranded, linear DNA molecule that circularizes and integrates into the chromosome in a site-specific manner. DNA sequences that cross-hybridize with K139 phage DNA are present in all strains of V. cholerae serogroup O1 of the classical biotype examined and in some strains of the El Tor biotype. Phage K139 produces plaques on El Tor O1 strains that do not carry the K139-related sequences but does not plaque on O139 strains that lack detectable phage DNA. This results suggests that O139 strains arose in part by horizontal gene transfer of the O139 antigen genes into an El Tor O1 strain that harboured a K139 prophage. Consistent with this interpretation, the morphology of K139 phage particles is identical to that displayed by the widely distributed family of O1 phages referred to as 'kappa'. In order to test whether K139 phage is involved in lysogenic conversion of V. cholerae, we constructed a novel mini-transposon, Tn10d-bla, which was designed to produce beta-lactamase fusions to phage-encoded, exported proteins. All Tn10d-bla insertions obtained were closely linked to one location on the K139 phage genome. DNA sequence determination of the fusion joints revealed an open reading frame (ORF1), encoding a gene product of 137 amino acids with a typical N-terminal hydrophobic signal sequence. ORF1 was designated the glo gene (G protein-like ORF) because its amino acid sequence shows similarity to eukaryotic Gs(alpha) protein (34.5% identity over an 81-amino-acid overlap) and its C-terminus displays the consensus motif (CAAX) which is found in many small eukaryotic GTP-binding proteins. LD50 assays with isogenic Glo+ and Glo- K139 lysogens suggest that glo encodes a secreted virulence determinant of V. cholerae. [TOP OF PAGE]
- Phenotypic variability among cells of Lactobacillus helveticus ATCC 15807. Reinheimer, J.A., Morelli, L., Bottazzi, V., Suarez, V. (1995). International Dairy Journal 5:97-103. Lactobacillus helveticus ATCC 15807 is a slime-producing, fast milk-coagulating strain. During growth under optimum conditions, it spontaneously produces variants able to ferment mannose (0-01% of the total population), and fructose (0.004%), which then remain stable through several subcultures. These variants did not revert, during our test, to the wild phenotype, whereas those clones unable to ferment fructose and mannose regularly produced fermenting variants. In addition, by using the lytic phage, ATCC 15807-B1, it was possible to determine that 0.004% of the cell population was phage resistant. Adsorption interference was the phage-resistance mechanism involved in these spontaneous mutants. The proteolytic activity was also shown to be heterogeneously distributed among cells of this strain, and it was possible to isolate clones with less and more proteolytic activity when compared with the parent strain. Every variant type retained other phenotypes of the wild-type strain such as cell and colony morphology and slime production. Plasmid DNA content did not seem to be involved in these phenotypic variations. The practical interest of this cell heterogeneity is discussed. [TOP OF PAGE]
- A continuous culture model to examine factors that affect transduction among Pseudomonas aeruginosa strains in freshwater environments. Replicon, J., Frankfater, A., Miller, R.V. (1995). Appl. Environ. Microbiol. 61:3359-3366. Transduction among Pseudomonas aeruginosa strains was observed in continuous cultures operated under environmentally relevant generation times, cell densities, and phage-to-bacterium ratios, suggesting its importance as a natural mechanism of gene transfer. Transduction was quantified by the transfer of the Tra super(-) Mob super(-) plasmid Rms149 from a plasmid-bearing strain to an F116 lysogen that served as both the recipient and source of transducing phages. In control experiments in which transduction was prevented, there was a reduction in the phenotype of the mock transductant over time. However, in experiments in which transduction was permitted, the proportion of transductants in the population increased over time. These data suggest that transduction can maintain a phenotype for an extended period of time in a population from which it would otherwise be lost. Changes in the numbers of transductants were analyzed by a two-part mathematical model, which consisted of terms for the selection of the transductant's phenotype and for the formation of new transductants. Transduction rates ranged from 10 super(-9) to 10 super(-6) per total viable cell count per ml per generation and increased with both the recipient concentration and the phage-to-bacterium ratio. These observations indicate an increased opportunity for transduction to occur when the interacting components are in greater abundance. [TOP OF PAGE]
- Effects of suspended particulates on the frequency of transduction among Pseudomonas aeruginosa in a freshwater environment. Ripp, S., Miller, R.V. (1995). Appl. Environ. Microbiol. 61:1214-1219. Transduction has been shown to play a significant role in the transfer of plasmid and chromosomal DNA in aquatic ecosystems. Such ecosystems contain a multitude of environmental factors, any one of which may influence the transduction process. It was the purpose of this study to show how one of these factors, particulate matter, affects the frequency of transduction. In situ transduction rates were measured in lake water microcosms containing either high or low concentrations of particulate matter. The microcosms were incubated in a freshwater lake in central Oklahoma. Transduction frequencies were found to be enhanced as much as 100-fold in the presence of particulates. Our results suggest that aggregations of bacteriophages and bacterial cells are stimulated by the presence of these suspended particulates. This aggregation increases the probability of progeny phages and transducing particles finding and infecting new host cells. Consequently, both phage production and transduction frequencies increase in the presence of particulate matter. [TOP OF PAGE]
- Infectivity of algal viruses studied by chlorophyll fluorescence. Rohozinski, J., Patil, P.N., Seaton, G.R. (1995). J. Gen. Virol. 76:2859-2862. [TOP OF PAGE]
- Biological UV dosimetry: A comprehensive problem. Ronto, G., Gaspar, P.G. (1995). Journal of Photochemistry and Photobiology B Biology 31:51-56. The biologically effective dose from environmental radiation was measured using phage T7 and uracil thin layer sensors in a dosimeter developed previously (Gy. Ronto, S. Gaspar and A. Berces, Phages T7 in biological UV dose measurement, J. Photochem. Photobiol. B: Biol., 12 (1992) 285-294; P. Grof, S. Gaspar and A. Berces, Uracil thin layers in dosimetry of UV radiation, Proc. Int. Symp. Budapest Biomedical Optics, Europe, 1993, to be published). Examples of measured daily and annual profiles are presented to demonstrate the possibilities and limits of biological dosimetry. In addition, phage T7, uracil sensor and Robertson-Berger meter results are compared. A comparison of model calculation data with the measured values is presented. On the basis of the results obtained, the application of biological dosimeters in both long-term field measurements and laboratory experiments is suggested. [TOP OF PAGE]
- Increasing the phage resistance of starter cultures. Ross, R.P., Fitzgerald, G.F., Coffey, A. (1995). pp. 110-118. In In Cogan, T., Ross, R.P., and Fox, P. (eds.), National Dairy Products Research Centre 4th Cheese Symposium. TEAGASC, Fermoy, Co. Cork. [TOP OF PAGE]
- Antibiotic resistance, plasmid content, phage type, and capsule type of Staphylococcus aureus isolates at a children's hospital. Salamah, A.A. (1995). New Microbiologica 18:41-51. One hundred clinical isolates of Staphylococcus aureus were obtained from Al-Solimaniah Children's Hospital, Riyadh, Saudi Arabia. The isolates were screened for their antibiotic susceptibility, plasmid profiles, phage types, and capsular polysaccharide types. A total of 29 antibiotic resistance patterns were obtained. Nine plasmids were detected and 18 plasmid profiles were obtained. Thirteen isolates were non-phage-typeable and 14 different phage-typing-patterns were obtained from the other 87 isolates. Thirty eight isolates were capsular polysaccharide type 8 and 56 were capsular polysaccharide type 5; the other 6 isolates were non typeable. According to the above typing criteria, the isolates were divided into 13 groups. Plasmid profiles were found to be superior to phage typing, whereas, phage typing was superior to the antibiogram as a technique for determining similarities and differences among S. aureus hospital isolates. [TOP OF PAGE]
- Temperate bacteriophages are common among Actinobacillus actinomycetemcomitans isolates from periodontal pockets. Sandmeier, H., van, W., Bar, K., Ankli, E., Maeder, M., Meyer, J. (1995). Journal of Periodontal Research 30:418-425. Actinobacillus actinomycetemcomitans is a suspected etiologic agent in destructive periodontal diseases. The detection of bacteriophages in A. actinomycetemcomitans in the subgingival plaque of patients with rapidly destructive forms of periodontitis led to the hypothesis that bacteriophage infection might increase the virulence of this bacterium (19). A. actinomycetemcomitans was isolated from 68 subjects from the Netherlands and Switzerland with localized juvenile periodontitis, rapidly progressing periodontitis, or adult periodontitis, and was tested for the presence of temperate bacteriophage with the overlay plate technique. More than half of the A. actinomycetemcomitans strains were found to release bacteriophage which formed individual plaques on indicator strains. Electron microscopy of preparations from 7 strains revealed virions with an icosahedral head and a contractile tail typical for double-stranded DNA bacteriophages. The presence of A. actinomycetemcomitans carrying temperate bacteriophage was not correlated with the composition of the subgingival microflora nor with the clinical form of periodontal disease. Destructive periodontal disease of subjects with phage-carrying A. actinomycetemcomitans was not more severe than of subjects with phage-free A. actinomycetemcomitans as determined by several clinical parameters. In contrast, the pocket depth and the attachment loss were significantly lower for adult periodontitis subjects with phage-carrying A. actinomycetemcomitans. It seems unlikely that the frequently occurring temperate bacteriophages increase significantly the virulence of A. actinomycetemcomitans. [TOP OF PAGE]
- Inhibition of the proliferation of the bacteriophages of lactic acid bacteria in milk in presence of gluconodelta-lactone. Saniez, M.H., Bauquis, A.C., Carini, S., Dusautois, C., Serpelloni, M. (1995). Sciences des Aliments 15:291-304. The antiphagic effect of glucono-delta-lactone (GDL) was studied by impedance measurement, acidification and counting. Lactococci, thermophilic lactic bacteria and their associated phages, and industrial mesophilic mixed strains with the corresponding cheesewheys containing phages were tested. The antiphagic effect of GDL is shown either by a reduction of the acidification delay (phagic attack delay) or by a lack of delay (phagic attack inhibition), when bacteria, phages and GOL are brought together. An activating effect of GDL on the growth of lactic acid bacteria is observed. Systematic addition of GOL to milk could reduce cheese making irregularity due to phage attacks. [TOP OF PAGE]
- L5 luciferase reporter mycobacteriophages: A sensitive tool for the detection and assay of live mycobacteria. Sarkis, G.J., Jacobs???, Hatfull, G.F. (1995). Molecular Microbiology 15:1055-1067. Recombinant bacteriophages provide efficient delivery systems for introducing reporter genes into specific bacterial hosts. We have constructed mycobacteriophage L5 recombinants carrying the firefly luciferase gene inserted into the tRNA region of the phage genome. Infection of Mycobacterium smegmatis by these phages results in expression of the luciferase gene and light emission. Fortuitously, the luciferase gene is expressed continuously in lysogens surviving infection. Synthesis of luciferase from a mycobacterial promoter created by cloning enables the detection of extremely small numbers of M. smegmatis cells. These reporter phages can be used to discriminate between drug-sensitive and drug-resistant strains of M. smegmatis, and may provide tools for the rapid identification and classification of antimycobacterial agents. [TOP OF PAGE]
- Characterization of TS-mutants of cyanophage N-1 by their inactivation by physical and chemical agents. Sarma, T.A., Singh, R. (1995). Acta Virol. 39:65-68. The effect of temperature, ultraviolet (UV) light and ethylenediaminetetraacetic acid (EDTA) on the stability of cyanophage N-1, infecting the cyanobacterium Nostoc muscorum was studied. Complete inactivation of the phage occurred at 60 degrees C in 6 mins. All the temperature-sensitive (ts) mutants exhibited faster inactivation at 50 degrees C than the wild type. UV light readily inactivated the particles of the wild giving a survival of 3.44% at a dose of 60 secs. All the ts-mutants were found to be more sensitive to UV light than the wild type. 10(-4) mol/l EDTA inactivated 40% of the wild type in 60 mins. 5 x 10(-4) mol/l EDTA inactivated the wild type nearly completely within 2 mins, while a similar inactivation of ts-mutants required only 90 secs. [TOP OF PAGE]
- Frequency of generalized transducing phages in natural isolates of the Salmonella typhimurium complex. Schicklmaier, P., Schmeiger, H. (1995). Appl. Environ. Microbiol. 61:1637-1640. [TOP OF PAGE]
- Pseudomonas aeruginosa bacteriophage in treatment of P. aeruginosa infetion in cystic fibrosis patients. Shabalova, I.A., Karpanov, N.I., Krylov, V.N., Sharibjanova, T.O., Akhverdijan, V.Z. (1995). 443. Zurich, Switzerland, International Cystic Fibrosis Association. Proceedings of IX International Cystic Fibrosis Congress. [TOP OF PAGE]
- Phenotypic conversions as a result of pseudolysogeny. Shaffer, J.J., Schrader, J.O., Kokjohn, T.A. (1995). <a href="http://nbiap.biochem.vt.edu/brarg/brasym95/shaffer95.htm">on-line</A>, ??? Although two of the life-styles of bacteriophages, lysis and lysogeny, have been studied intensively, pseudolysogeny or the unstable carrier-state has been virtually unstudied since it was first recognized. The characterization of pseudolysogeny has made so little progress that researchers have not even been able to agree on a definition of this unusual state which is known to occur in many of the lytic bacteriophage. This lack of research may be due to the highly unstable nature of the pseudolysogen. ¶ The goal of our research is to characterize the interactions of the bacterium and the pseudolysogenic bacteriophage and to elucidate the role of the pseudolysogen in nature. Our research has revealed several phenotypic changes that occur in the host cell after infection. In some instances, the cell's pigment changes dramatically from normal pyocyanin blue to a brown with varying intensities. The pseudolysogens are more resistant to ultraviolet light and hydrogen peroxide. These new phenotypes could play an important role in the survival of the bacteria and phage in the natural ecosystem. <a href="http://nbiap.biochem.vt.edu/brarg/brasym95/shaffer95.htm">Full text is also available</A>. [TOP OF PAGE]
- INACTIVATION OF PHAGE MS2 BY TITANIUM DIOXIDE PHOTOCATALYSIS (VIRAL DISINFECTION). SJOGREN, J.C. (1995). University of Arizona. Viral disinfection by near-UV photocatalysis was accomplished in aqueous titanium dioxide suspensions. A photocatalyzed inactivation of phage MS2 of 90% increased to 99.9% after 2 $/mu$M Fe (from ferrous sulfate) was added to phosphate-buffered, distilled water containing TiO$/sb2$ and 20 $/mu$M Tris hydrochloride. Iron additions ranging from 0.2 to 20 $/mu$M, showed that a 2 $/mu$M Fe concentration produced maximum photoreactivity. The initial rate of MS2 inactivation, in the solution without iron, increased more than twenty-fold when Tris was absent. This rate of inactivation showed an additional nine-fold increase when the MS2 was photocatalyzed in a sample of Tucson groundwater, primarily because of low concentrations of groundwater species that scavenge hydroxyl radicals. A 99.997% inactivation of MS2 was observed after a 1000-ml glass beaker, containing a 100-ml suspension of MS2-spiked groundwater and 1 g l$/sp[-1]$ TiO$/sb2$, was exposed to sunlight for 10 sec. The hydroxyl radical (OH$/sp/cdot$) was linked to the MS2 destruction by verifying the ability of OH$/sp/cdot$ to inactivate MS2, and by demonstrating that OH$/sp/cdot$ was produced during the photocatalyzed reactions. An OH$/sp/cdot$ source, and competition kinetics techniques, were used to obtain these findings and to produce other evidence of MS2 inactivation by photocatalytically-produced OH$/sp/cdot$. These methods were also used to show that the presence of 2 $/mu$M Fe increased the quantity of liquid-phase OH$/sp/cdot$ that was produced during photocatalysis. Measurements showed that most of the added 2 $/mu$M Fe partitioned onto the TiO$/sb2$ surface, allowing the opportunity for OH$/sp/cdot$ production by Fenton reactions. Experimental results were consistent with proposed photocatalytic mechanisms (involving photocatalysis, diffusion, and Fenton reaction) by which OH$/sp/cdot$ was available on and off the TiO$/sb2$ surface. Non-OH$/sp/cdot$ means of MS2 inactivation were evaluated. The MS2 inactivation that occurred in unilluminated solutions to which Fe and TiO$/sb2$ were added, was probably caused by the effects of stirring, oxidation by iron, and MS2 enmeshment in aggregating TiO$/sb2$ particles. [TOP OF PAGE]
- A novel locus of Yersinia enterocolitica serotype O:3 involved in lipopolysaccharide outer core biosynthesis. Skurnik, M., Venho, R., Toivanen, P., al-Hendy, A. (1995). Molecular Microbiology 17:575-594. Yersinia enterocolitica serotype O:3 strain 6471/76-c (YeO3-c) was sensitive to bacteriophage phi R1-37 when grown at 37 degrees C but not when grown at 22 degrees C because of steric hindrance by abundant lipopolysaccharide (LPS) O-side chain (O-antigen) expressed at 22 degrees C. The transposon library of YeO3-c was grown at 37 degrees C and screened for phage phi R1-37-resistant transposon insertion mutants. Three types of mutant were isolated: (i) phage receptor mutants expressing O-antigen (LPS-smooth), (ii) phage receptor mutants not expressing O-antigen (LPS-rough), and (iii) LPS-smooth mutants with the phage receptor constitutively sterically blocked. Mutant type (i) was characterized in detail; the transposon insertion inactivates an operon, named the trs operon. The main findings based on this mutant are: (i) the frs operon is involved in the biosynthesis of the LPS outer core in YeO3-c; the nucleotide sequence of the trs operon revealed eight novel genes showing similarly to known polysaccharide biosynthetic genes of various Gram-negative bacteria as well as to capsule biosynthesis genes of Staphylococcus aureus; (ii) the biosynthesis of the core of YeO3-c involves at least two genetic loci; (iii) the trs operon is required for the biosynthesis of the bacteriophage phi R1-37 receptor structures; (iv) the homopolymeric O-antigen of YeO3-c is ligated to the inner core in Y. enterocolitica O:3; (v) the trs operon is located between the adk-hemH and galE-gsk gene pairs in the Y. enterocolitica chromosome; and (vi) the phage phi R1-37 receptor is present in many but not in all Y. enterocolitica serotypes. The results also allow us to speculate that the trs operon is a relic of the ancestral rfb region of Y. enterocolitica O:3 carrying genes indispensable for the completion of the core polysaccharide biosynthesis. [TOP OF PAGE]
- [Phenotypic analysis of two morphologically different types of Vibrio cholerae 0139 colonies]. Smirnova, N.I., Chekhovskaia, G.V., Davydova, N.I., Livanova, L.F., Eroshenko, G.A., Ostroumova, N.M. (1995). Molekuliarnaia Genetika, Mikrobiologia, i Virusologa 30-34. A clinical isolate Vibrio cholerae P16064 serogroup 0139 was shown to produce two different kinds of colonies: opaque encapsulated and translucent devoid of capsule. Low virulence of translucent colonies seems to be due to not only loss of capsule which determines serum resistance, but also to decreased expression of genes controlling the motility, and production of protease and mannose-sensitive adhesion pili. Analysis of the lysogenic properties of the two types of colonies permitted us to propose that simultaneous spontaneous alteration of capsule production and the above-mentioned virulence factors in translucent colonies may be caused by a temperate phage in turbid clones of strain P16064. [TOP OF PAGE]
- Comparative reductions of hepatitis A virus, enteroviruses and coliphage MS2 in miniature soil columns. Sobsey, M.D., Hall, R.M., Hazard, R.L. (1995). Water Science and Technology 31:203-209. [TOP OF PAGE]
- Presence of large virus-like particles in a eutrophic reservoir. Sommaruga, R., Krössbacher, M., Salvenmoser, W., Catalan, J., Psenner, R. (1995). Aquat. Microb. Ecol. 9:305-330. The presence of large virus-like particles without tail was observed in the water of a severely eutrophied freshwater reservoir. We used transmission electron microscopy (TEM) coupled to a semiautomatic image analysing system to study the size distribution of aquatic viruses. The LVLP had maximum head diameters between 195 and 210 nm. Although the affiliation and host of the LVLP are unknown similarities in size and shape were found with the African swine fever virus. The diffuse organic contamination from piggeries in the catchement area may explain the presence of these LVLP. The overlap in size of the LVLP with the smallest bacteria observed imply serious methodological problems to distinguish these communities under the epifluorescence microscope. Therefore, although at present we do not know how common are LVLP in other aquatic systems we discourage the use of epifluorescence microscopy for viral abundance estimations during routine work. [TOP OF PAGE]
- Synergistic inactivation of Escherichia coli and MS-2 coliphage by chloramine and cupric chloride. Straub, T.M., Gerba, C.P., Zhou, X., Price, R., Yahya, M.T. (1995). Water Res. 29:811-818. Reaction of free chlorine with organic compounds in water during drinking water treatment may lead to the formation of potentially carcinogenic compounds known as trihalomethanes (THMs). Monochloramine and metals have been investigated as alternative disinfectants. However, the action of either disinfectant alone requires greater concentrations and longer contact times compared to free chlorine. This experiment evaluated the efficacy of combining monochloramine (1-2.5 mg/l) and copper in the form of cupric chloride (0.1-0.8 mg/l) to determine if inactivation of MS-2 coliphage and Escherichia coli was synergistic and thereby decreasing the concentration and contact time for adequate inactivation of these organisms. Combination of 5 mg/l monochloramine and 0.1-0.4 mg/l cupric chloride was sufficient to produce a 3 log sub(10) inactivation of MS-2 coliphage after 10 min. Nearly 120 min was required for the same log sub(10) inactivation of MS-2 using 5 mg/l monochloramine alone and less than a 0.5 log sub(10) reduction was observed after 120 min using 0.4 mg/l cupric chloride alone. A 6 log sub(10) reduction of E. coli was observed after 10- and 20-min exposures to 2.5 mg/l monochloramine and 0.8 or 0.4 mg/l cupric chloride, respectively. To achieve the same inactivation of E. coli using monochloramine alone, a concentration and contact time of 5 mg/l for 60 min was required. No inactivation of E. coli was observed after exposure to 0.4 or 0.8 mg/l cupric chloride after 60 min. Synergism was demonstrated in the inactivation of both organisms using the combined chloramine copper system. [TOP OF PAGE]
- A diagnostic bacteriophage for Enterobacter cloacae. [Chinese]. Sun, J., He, X., Zhang, S. (1995). Zhonghua Weishengwuxue He Mianyixue Zazhi 15:332-335. There were 24 bacteriophages isolated from 3 specimens of hospital sewages using 34 cultures of Enterobacter cloacae as propagating strains. One of them, named phage Ent, could lyse 164 of 189 cultures (86.8%) of E. cloacae and all of the following cultures were resistant to this phage, i.e. Enterobacter aerogenes (27), Klebsiella spp. (67), Citrobacter freundii (158), C. diversus (4), Hafnia alvei, (36), Pantoa dispersa (1), Kluyvera ascorbata (3), Escherichia coli (858), shigella spp. (1091), Salmonella spp. (1527), Yersinia enterocolitica (250), Proteus spp. (96), Providencia spp. (21), and Morganella spp. (57). Therefore, the phage Ent is highly specific for E. cloacae, and suitable for identification of Enterobacteriaceae routinely. The lysis rate of phage Ent estimated from different biotypes of E. cloacae was also discussed in this paper. [TOP OF PAGE]
- Pili of Pseudomonas syringae pathovar syringae enhance initiation of bacterial epiphytic colonization of bean. Suoniemi, A., Bjorklof, K., Haahtela, K., Romantschuk, M. (1995). Microbiology (Reading) 141:497-503. Pseudomonas syringae pathovar syringae R32 expresses phage-vphi-6-specific pili that function as adhesins anchoring bacterial cells to the surface of plants. Phage-resistant piliated and non-piliated mutants were compared to the wildtype strain with regards to pellicle formation and performance during different phases of epiphytic colonization of bush bean. The degree of piliation did not affect the ability of the strains to grow on the undisturbed plant surface. The presence of pili did, however, correlate strongly with the efficiency of the strains to initiate colonization from a liquid inoculation suspension if unadsorbed bacteria were removed by rinsing. During early colonization, wild-type bacteria became virtually resistant to displacement by rinsing within 1 d after inoculation, whereas non-piliated mutant bacteria became only partly resistant within 3 d. Piliated cells formed a pellicle on the surface of stationary liquid cultures whereas non-piliated mutant strains did not. A mechanism similar to pellicle formation may be functional on the plant surface, explaining in part the difference in resistance to removal by rinsing. [TOP OF PAGE]
- Viruses infecting the marine prymnesiophyte Chrysochromulina spp.: Isolation, preliminary characterization and natural abundance. Suttle, C.A., Chan, A.M. (1995). Mar. Ecol. Prog. Ser. 118:275-282. Sixty-four natural virus communities were concentrated from seawater collected from three locations in Texas' coastal waters (Gulf of Mexico, 27°; 31' N, 96°; 18' W; Aransas Pass 27°; 50' N, 97°; 02' W; Laguna Madre, 27°; 30' N, 97°; 18' W) and screened for the presence of lytic pathogens which infect the marine Prymnesiophyte (Haptophyte) Chrysochromulina brevifilum. Viruses were detected in 16 of the samples and ranged in abundance from 2 to 688 infectious units per liter. The pathogens were detected at the 3 locations, but not on all dates, from December through June when water temperatures were less than 28°;C. A clonal isolate of the virus (CbV-PW1) was obtained by determining the concentration of the infectious agent by a most-probable-number assay and adding 0.2 of an infective unit into each of 20 exponentially growing cultures, removing an aliquot from a culture which lysed and repeating the procedure. The isolate also caused lysis of Chrysochromulina strobilus, but did not lyse 8 other isolates of Chrysochromulina or 5 other genera of Prymnesiophytes that were screened. The double-stranded DNA virus is a polyhedron of about 145-170 nm in diameter with a heavily staining central region that is distinct from the capsid. The appearance of the virions is associated with a granular region in the cytoplasm that does not appear within uninfected cells. Ultimately, viral production results in disruption of the organelles, lysis of the cell and release of the virus particles. Although the number of viruses produced per lytic event is presently unknown we have counted more than 320 virus particles in a single ultrathin section of an infected cell. These results suggest that viruses are likely important in regulating Chrysochromulina populations in the sea and may be the reason that blooms of the genus are relatively rare and ephemeral. [TOP OF PAGE]
- The cDNA sequence of Trichomonas vaginalis virus-T1 double-stranded RNA. Tai, J.H., Ip, C.F. (1995). Virology 206:773-776. Trichomonas vaginalis virus (TVV) is a nonsegmented double-stranded (ds) RNA virus that infects the pathogenic protozoan T. vaginalis. To study the virus, we cloned the genomic ds RNA of a TVV-T1 isolate and obtained a contiguous 4647-bp cDNA sequence. Two overlapping genes separated by a + 1 reading frame shift were identified on the plus strand but none on the complementary strand RNA in this sequence. The upstream gene probably encodes a 75-kDa capsid protein, and the downstream gene encodes an 86-kDa polypeptide which is probably the viral RNA-dependent RNA polymerase (RDRP). A potential ribosomal slippage heptamer (C CUU UUU) was identified within the 14-nt overlap of the two genes. The genomic organization and RDRP sequence in TVV-T1 exhibit similarity to those of Saccharomyces cerevisiae virus and Leishmania RNA virus, suggesting that these viruses originate from common ancestry, but are only distantly related to Giardia lamblia virus. [TOP OF PAGE]
- Biological properties of bacteriophages revealed throughout the manufacturing process of an industrial strain E. coli M 17. Tediashvili, M., Chanishvili, N., Eliashvili, T., Zviadadze, N., Porchkhidze, K., Natroshvili, G., Cholokashvili, N., Giorkhelidze, D., Adamia, R., Chanishvili, T. (1995). Proceedings of the Georgian Academy of Sciences 21:175-184. [TOP OF PAGE]
- Differential mortality of two closely related host species induced by one parasite. Thomas, F., Renaud, F., Rousset, F., Cezilly, F., De Meeüs, T. (1995). Proc. R. Soc. Lond. B 260:349-352. Understanding the importance of parasites in affecting the biodiversity of host species in ecosystems is a central aim of conservation biology. Recent advances in ecology have suggested that differential parasite susceptibilities between taxonomically related host species may be a determinant of animal community structure. Although conceptually appealing, such an hypothesis suffers from a lack of field evidence. Here, we report that the populations of two congeneric and sympatric host species (Gammarus insensibilis and G. aequicauda), infected by the same parasite (Microphallus papillorobustus), exhibit a strongly contrasted pattern of parasite-induced mortality. [TOP OF PAGE]
- Nutritional enrichment of a microbial community: The effects on activity, elemental composition, community structure and virus production. Tuomi, P., Fagarbakke, K.M., Bratbak, G., Heldal, M. (1995). FEMS Microbiol. Ecol. 16:123-124. Viruses are active members of the microbial community in natural waters but little is known about the factors that regulate their activity and production. In this study we have investigated the effects of increased availability of organic nutrients and inorganic phosphate on activity, elemental composition, community structure and virus production in a natural bacterial community. The fraction of active cells in the community as estimated from microautoradiography of cells assimilating 3H-labeled thymidine ranged from 0-22%, but changes in the elemental composition of the cells indicated that more than 90% of the cells were active. The increase in carbon and energy availability stimulated virus production more than bacterial biomass production, while the increase in phosphate availability stimulated biomass production rather than virus production. A decrease in morphological diversity of the bacterial community was paralleled by a reduction in the virus-to-bacteria ratio (VBR) but the relationship between bacterial diversity and viral activity is uncertain. Our general conclusion is that nutrient availability, in addition to the bacterial activity, also affects the viral activity, and that both of these may affect the structure and diversity of the bacterial community. [TOP OF PAGE]
- Comparison of F-specific bacteriophage, enterococci, and faecal coliform densities through a wastewater treatment process employing oxidation ponds. Turner, S.J., Lewis, G.D. (1995). Water Science and Technology 31:85-89. [TOP OF PAGE]
- Giant chlorella viruses. Van Etten, J.L., Van Etten, J. (1995). Mol. Cells 5:99-106. [TOP OF PAGE]
- Use of two short-term tests to evaluate the genotoxicity of river water treated with different concentration/extraction procedures. Vargas, V.M.F., Guidobono, R.R., Jordao, C., Henriques, J.A.P. (1995). Mutat. Res. - Genet. Toxicol. Test. 343:31-52. The genotoxicity of river water samples was evaluated by the Salmonella mutagenicity assay and by the microscreen phage-induction assay. Different processes of sample treatment were compared using the following assays: different volumes of a non-concentrated sample (direct method); concentrated sample fractionated into portions with acid, basic and neutral activity (liquid-liquid extraction method); sample submitted to extraction of volatile substances (volatile extraction method). Samples that were positive to the Salmonella assay by the direct concentration method lost this activity after liquid-liquid extraction. This difference was related to the loss of substances that volatilize during the extraction process. The study of volatile product concentrates confirmed the role of these compounds in inducing activity present in some samples. The microscreen phage-induction assay proved to be a good screening assay for genotoxic compounds present in small concentration in environmental samples. We conclude that, whenever possible, samples should be treated by the direct method in different volumes to prevent the loss of genotoxic substances. [TOP OF PAGE]
- Increased in bacteriophage radiation resistance as a result of enhanced expression of stress systems in host cells. Verbenko, V.N., Kalinin, V.K. (1995). Genetika 31:1630-1636. By means of polyacrylamide gel electrophoresis (PAGE) of proteins from radiation-resistant Gamr mutants of Escherichia coli, it was shown that induction and elimination of RecA protein in these mutants are kinetically more rapid than in wild type cells, and heat-shock proteins (HSP) are hyperproduced even at a normal temperature (320 C). gamma- and UV-irradiated bacteriophages were used to study the results of simultaneous enhanced expression of two stress repair systems. Radiation-resistant mutants are similar to wild type cells in their ability to reactivate phages lambdaCI, phi80 vir, and T 4D inactivated by gamma-rays and UV-light. W-reactivation of gamma-irradiated phages lambda and 80 vir is respectively 1.5 and 1.2 times higher in Gamr cells in which maximal w-reactivation was observed at wide range of doses (from 300 to 2000 Gy) whereas in wild type cells the peak of W-reactivation was registered at doses of 400 to 450 Gy. The phage lambda gamma-, irradiated upon adsorption on the cells of a radiation-resistant mutant, was two times more resistant to gamma-rays (DMF = 2 at LD10) than when irradiated upon adsorption on wild type cells. Postirradiation degradation of the phage lambda DNA, when irradiated within Gamr cells, was significantly lower than in wild type cells, and preirradiation of the cells decreased phage DNA degradation (12% in Gamr cells and 30% in wild-type cells). The role of an increased HSP level and expression of SOS-regulon in radiation resistance and possible interaction of stress systems in bacterial cells are discussed. [TOP OF PAGE]
- Morphological diversity of rumen bacteriophages in bovine. Vijayarani, K., Prabha, N.R.G., Chandramohan, A., Nachimuthu, K., Padmanaban, V.D. (1995). Indian Journal of Animal Sciences 65:749-750. [TOP OF PAGE]
- Induction of a Cryphonectria parasitica Cellobiohydrolase I Gene is Suppressed by Hypovirus Infection and Regulated by A GTP-Binding-Protein- Linked Signaling Pathway Involved in Fungal Pathogenesis. Wang, P., Nuss, D.L. (1995). Proc. Natl. Acad. Sci. USA 92:11529-11533. Extracellular cellulase activity is readily induced when the chestnut blight fungus Cryphonectria parasitica is grown on cellulose substrate as the sole carbon source. However, an isogenic C. parasitica strain rendered hypovirulent due to hypovirus infection failed to secrete detectable cellulase activity when grown under parallel conditions. Efforts to identify C. parasitica cellulase-encoding genes resulted in the cloning of a cellobiohydrolase (exoglucanase, EC 3.2.1.91) gene designated chb-1. Northern blot analysis revealed an increase in cbh-1 transcript accumulation in a virus-free virulent C. parasitica strain concomitant with the induction of extracellular cellulase activity. In contrast, induction of cbh-1 transcript accumulation was suppressed in an isogenic hypovirus-infected strain. Significantly, virus-free C. parasitica strains rendered hypovirulent by transgenic cosuppression of a GTP-binding protein subunit were also found to be deficient in the induction of cbh-1 transcript accumulation. [TOP OF PAGE]
- Temporal and spatial distribution of viruses and dissolved DNA in the northern Adriatic Sea. Weinbauer, M.G., Fusk, D., Puskaric, S., Peduzzi, P. (1995). Microb. Ecol. 30:25-41. [TOP OF PAGE]
- Diel, seasonal, and depth-related variability of viruses and dissolved DNA in the Northern Adriatic Sea. Weinbauer, M.G., Fuks, D., Puskaric, S., Peduzzi, P. (1995). Microb. Ecol. 30:25-41. [TOP OF PAGE]
- Effect of virus-rich high molecular weight concentrates of seawater on the dynamics of dissolved amino acids and carbohydrates. Weinbauer, M.G., Peduzzi, P. (1995). Mar. Ecol. Prog. Ser. 127:245-253. [TOP OF PAGE]
- Significance of viruses versus heterotrophic nanoflagellates for controlling bacterial abundance in the northern Adriatic Sea. Weinbauer, M.G., Peduzzi, P. (1995). J. Plank. Res. 17:1851-1856. [TOP OF PAGE]
- Phylogenetic analysis of Leishmania RNA virus and Leishmania suggests ancient virus-parasite association. Widmer, G., Dooley, S. (1995). Nucleic Acids Research 23:2300-2304. Some strains of the protozoan parasite Leishmania belonging to the new world species guyanensis and braziliensis are infected with persistent, single-segmented, non-enveloped dsRNA viruses termed LRV1. A single old world strain classified as L. major was recently found to harbor a similar virus, designated LRV2-1. The genomic nucleotide sequences of two LRV1 types (1-1 and 1-4) isolated from two L. guyanensis strains have been determined and found to be highly conserved. In contrast, LRV1-specific cDNA probes derived from the conserved genomic 5' region failed to recognize LRV2 RNA on Northern blots, suggesting a greater degree of divergence between LRV1 and LRV2 than among LRV1 types. This observation suggests a long-term association and coevolution of LRV within each parasite strain. We tested this concept by comparing nucleotide sequences of seven LRV types and PCR fingerprints of the parasite strains from which these viruses were derived. In support of the idea of virus-parasite co-evolution, we find that genetic distances between LRV types mirror the heterogeneity between parasite fingerprints and are clustered according to the geographical origin of the strains. In agreement with the postulated common origin of persistent dsRNA viruses of protozoa and fungi, we conclude that the infection of Leishmania with LRV pre-dates the divergence of Leishmania into different lineages. [TOP OF PAGE]
- Suppression of Leishmania RNA virus replication by capsid protein overexpression. Widmer, G. (1995). J. Virol. 69:4122-4126. Some strains of the protozoan parasite genus Leishmania are persistently infected with single-segmented double-stranded RNA viruses, which are termed LRV. The function of these cytoplasmic viruses is unknown. In order to address the question of whether LRV affects the parasite's phenotype, pairs of isogenic LRV(+)-LRV- lines are required. Since the persistent nature of these viruses precludes de novo infection of virus-negative strains, LRV(+)-LRV- strains were transformed with a Leishmania expression vector expressing the LRV capsid protein with the aim of determining if LRV- promastigotes support capsid assembly and if LRV replication is affected by excess capsid protein. I found that in LRV- promastigotes, capsid protein was capable of self-assembly into virus-like capsids and that capsid overexpression in a naturally infected LRV+ line resulted in a progressive reduction in LRV copy number. Clonal lines derived from an LRV+ capsid overexpressor had no detectable levels of LRV. These results demonstrate that LRV replication can be inhibited and that a significant reduction of viral copy number has no effect on the parasite's viability in liquid medium. [TOP OF PAGE]
- The association of bdelovibrios with surfaces in the aquatic environment. Williams, H.N., Kelley, J.I., Baer, M.L., Turng, B.F. (1995). Canadian Journal of Microbiology 41:1142-1147. In the aquatic environment, the association of microorganisms with surfaces represents an important phase in the life cycle and ecology of many microbial species. However, previous studies to understand the ecology of the bdellovibrios have ignored examination of the role of surfaces and surface association. In this report, the association of bdellovibrios with sterile surfaces and the stability of the organisms on abiotic and biotic surfaces were investigated. Sterilized oyster shells, glass slides, and steel and titanium surfaces were submerged in the Patuxent River. Following submersion for periods ranging from 2 h to 1 week, test surfaces were scraped or brushed to remove adherent biofilm surface material. The resulting suspension of surface biofilm was cultured for total numbers of bacterial colony-forming units and bdellovibrio plaque-forming units. In other experiments on the persistence of bdellovibrios on surfaces, mussel shells and tunicates with accumulated biofilm were exposed to repeated treatments of mechanical agitation. Following each treatment, the suspension supernatant was cultured for the numbers of predators released from the surface. The results of the two investigations revealed that bdellovibrios associate with surfaces following brief periods of submersion in natural waters, the type of surface influences the association, the number of the predators recovered increased with the time of submersion to a certain peak, and the predators on surfaces are relatively resistant to removal by physical agitation of the surrounding water. [TOP OF PAGE]
- Transfer, methylation and spontaneous mutation frequency of Phi X174am3cs70 sequences in medaka (Oryzias latipes) and mummichog (Fundulus heteroclitus): Implications for gene transfer and environmental mutagenesis in aquatic species. Winn, R.N., Van Beneden, R.J., Burkhart, J.G.A. (1995). Marine environmental research. London [Mar. Environ. Res. ] 40:247-265. This study describes the production of transgenic medaka (Oryzias latipes) and mummichog (Fundulus heteroclitus) containing multiple copies of the bacteriophage Phi X174am3cs70. This work is an initial approach for measuring mutations in aquatic species using the same gene target sequence in fish and laboratory mammals. The Phi X174 sequence is unique in that there is no detectable homology with chromosomal DNA of medaka, mummichog or mice. The authors have compared cytoplasmic injection of 1-2 cell embryos with linear single copy and catenated constructs of the phage DNA. The catenated construct results in greater efficiency of gene transfer for both species in terms of copies per cell. Analyses of DNA from founder transgenic fish with methylation sensitive (HpaII) and methylation insensitive (MspI) restriction enzyme isoschizmers indicates CpG methylation of the integrated Phi X174 sequence. This study also demonstrates the efficient rescue of live phage from the chromosomal DNA of founder fish in sufficient numbers to determine a spontaneous mutation frequency for reversion of am3. A pooled sample of 20 mu g DNA from four fish yielded 1.09 x 10 super(7) progeny phage with a spontaneous mutation frequency of 1.83 x 10 super(-7). This spontaneous mutation frequency is similar to the spontaneous frequency for the same gene indictor recovered from transgenic mice. These results demonstrate that fish containing multiple copies of Phi X174 can be produced with no obvious detrimental effects and that the overall approach may be useful in basic and applied studies of environmental mutagenesis. [TOP OF PAGE]
- A simple method for the concentration of viruses from natural water samples. Wommack, K.E., Hill, R.T., Colwell, R.R. (1995). J. Microbiol. Meth. 22:57-67. A double filtration method for the concentration of viruses from water was developed. The procedure involves prefiltering a water sample through 0.22 mm and 0.1 µm filters, concentrating viruses in the 0.1 µm filtrate using a 10,000 molecular weight cut-off (mwco) filter. In tests utilizing bacteriophage host systems (PHS) isolated from the Chesapeake Bay, this method was shown to have an average recovery efficiency of 76.5% for viable bacteriophage. It was also possible to recover 100% of the virus-like particles observed in natural water samples. The recovery of bacteriophages and virus-like particles using our method compared well with other reported virus concentration methods employing adsorption/elution and ultrafiltration. Furthermore, the procedure is inexpensive and well suited to field applications. [TOP OF PAGE]
- Effects of Temperature and Host Cell Growth Phase on Replication of F-Specific RNA Coliphage QB. Woody, M.A., Cliver, D.O. (1995). Appl. Environ. Microbiol. 61:1520-1526. Human enteric viruses have been found in groundwater in the absence of fecal coliforms. Because detection of human enteric viruses is costly, time-consuming, and lacking in sensitivity F-specific RNA (FRNA) coliphages, which infect Escherichia coli by attachment to F pili, are being examined for suitability as indicators of human enteric viruses in groundwater. Temperatures and host cell growth conditions that constrain F-pilus expression will limit FRNA coliphage replication in groundwater and wastewater, as is desirable in an indicator. Below 25 degree C F-pilus synthesis ceases; FRNA coliphage Q-beta did not replicate below this temperature in batch cultures. One-step replication studies indicated that the replicative cycle is prolonged and that fewer progeny are released as the temperature decreases. The decreases in phage replication observed in the one-step replication studies were a consequence of fewer cells infected as the temperature was lowered or as host cells entered stationary phase. The numbers of phage particles released from infected cells did not change. The minimum temperature for replication of Q-beta, 25 degree C, is not maintained in wastewater and does not occur in Wisconsin groundwater. On the basis of temperature and host cell growth phase, we have concluded that extensive replication of FRNA coliphages does not occur in wastewater and groundwater in Wisconsin and areas with similar cool climates. [TOP OF PAGE]
- Effect of testing method on apparent activities of viral disinfectants and antiseptics. Woolwin, J.D., Gerberding, J.L. (1995). Antimicrobial Agents & Chemotherapy 39:921-923. [TOP OF PAGE]
- DNA sequence of tail fiber genes of coliphage 186 and evidence for a common ancestor shared by dsDNA phage fiber genes. Xue, Q., Egan, J.B. (1995). Virology 212:128-133. We present here the nucleotide sequence of the tail fiber genes of phage 186. Marker rescue was used to associate an open reading frame (ORF) of 462 codons with the previously known tail gene K. A downstream ORF, encoding a 166-amino-acid product, was designated orf 45. Comparative studies suggested that K encodes the tail fiber protein and that orf 45 encodes an assembly protein. K protein contains a succession of short amino acid sequences (motifs) that are homologous with sequences from the tail fiber proteins of unrelated bacteriophages. The fact that these sequence motifs are variously present in the tail fiber proteins of unrelated bacteriophages has been advanced as evidence for horizontal transfer in the evolution of the associated tail fiber genes. However, the fact that the order of the various motifs in the proteins is invariant emphasizes the probability that independent divergence from a common ancestor also played a major role in the evolution of the tail fiber genes. [TOP OF PAGE]
- Programmed cell death in bacterial populations. Yarmolinsky, M.B. (1995). Science 267:836-837. [TOP OF PAGE]
- TRANSDUCTION OF PSEUDOMONAS AERUGINOSA BY PHAGE F116(RMS149) IN SOIL (GENE TRANSFER). Yin, X. (1995). New York University. There have been relatively few studies on transduction in natural habitats. Consequently, the occurrence, frequency, and characterization of transduction of Pseudomonas aeruginosa by phage F116(Rms149) in soil was studied. To eliminate the possibility that gene transfer was by conjugation or transformation, a Tra$/sp-$Mob$/sp-$plasmid (Rms149) and bacteria-free phage lysates were used in the presence of DNase. Based on antibiotic-resistance patterns of different strains of P. aeruginosa, indigenous microorganisms, and transductants, P. aeruginosa RM242 was selected for bacterial lawns for phage titering and as the recipient in soil. Pseudomonas Isolation Agar (PIA) or Luria Complete Agar (LA) containing 500 $/mu$g/ml of nalidixic acid (Nal$/sb[500])$ + 200 $/mu$g/ml of cycloheximide (Cy$/sb[200])$ was used for viable bacterial counts and phage titers, and PIA or LA containing Nal$/rm/sb[500] + Cy/sb[200] + Cb/sb[500]$ (500 $/mu$g/ml of carbenicillin) was used as the selective medium for transductants. Direct titering of F116 in soil dilutions on lawns of antibiotic-resistant RM242 growing on antibiotic-containing media was better for enumeration of phases than after filtration or centrifugation of the dilutions. Effects of incubation time, media, MOI, temperature, bacterial strains, relative concentration of phases and bacteria, reaction buffer, pH, and the physicochemical characteristics of soil on frequency of transduction were studied in vitro and in sterile and nonsterile soils. More transductants developed on selective LA than on selective PIA, but more indigenous microorganisms grew on selective LA. More transductants were detected in sterile than nonsterile soil, in nonsterile soil amended with montmorillonite than with kaolinite, and in nonsterile soil amended with CaCO$/sb3.$ The pH affected the frequency of transduction in soil, but the sequence of inoculation of recipient and phage had only a minor effect. Transductants were detected 21 days after the addition of RM242 or F116 to nonsterile soil originally inoculated with either F116(Rms149) or RM242, respectively. Putative transductants were confirmed by growth on various combinations of antibiotics, plasmid isolation, and restriction enzyme digestion followed by agarose gel electrophoresis. [TOP OF PAGE]
- Virus-mediated expression of firefly luciferase in the parasitic protozoan Giardia lamblia. Yu, D.C., Wang, A.L., Wu, C.H., Wang, C.C. (1995). MOLECULAR AND CELLULAR BIOLOGY 15:4867-4872. Giardia lamblia, a prevalent human pathogen and one of the lineages that branched earliest from prokaryotes, can be infected with a double-stranded RNA virus, giardiavirus (GLV). The 6,277-bp viral genome has been previously cloned (A.L. Wang, H.-M. Yang, K.A. Shen, and C.C. Wang, Proc. Natl. Acad. Sci. USA 90:8595-8599, 1993; C.-H. Wu, C.C. Wang, H.M. Yang, and A.L. Wang, Gene, in press) and was converted to a transfection vector for G. lamblia in the present study. By flanking the firefly luciferase gene with the 5' and 3' untranslated regions (UTRs) of the GLV genome, transcript of the construct was synthesized in vitro with T7 polymerase and used to transfect G. lamblia WB trophozoites already infected with GLV (WBI). Optimal electroporation conditions used for the transfection were set at 1,000 V/cm and 500 microF, which resulted in expression of significant luciferase activity up to 120 h after electroporation. Furthermore, the mRNA and the antisense RNA of the luciferase gene were both detected by reverse transcription and PCR from 6 to 120 h postelectroporation, whereas no antisense RNA of luciferase was observed in the electroporated virus-free Giardia WB trophozoites. The mRNA of luciferase was detectable in the virus-free trophozoites by reverse transcription and PCR only up to 20 h after the electroporation, indicating that the introduced mRNA was replicated only by the viral RNA-dependent RNA polymerase inside the WBI cells. This expression of luciferase was dependent on the presence of UTRs on both ends of the viral genome transcript, including a putative packaging site that was apparently indispensable for luciferase expression. [TOP OF PAGE]
- The role of viruses in the dynamics of phytoplankton blooms. Zingone, A. (1995). G. Bot. Ital. 129:415-423. [TOP OF PAGE]
- Characterization of cryptic prophages (monocins) in Listeria and sequence analysis of a holin/endolysin gene. Zink, R., Loessner, M.J., Scherer, S. (1995). Microbiology 141:2577-2584. Monocins in Listeria were induced by UV-irradiation of liquid cultures, and defective phage particles were purified from the lysates. Electron microscopy showed flexible, non-contractile bacteriophage-tail-like particles, consisting of specific proteins of molecular mass 20-45 kDa and pI 4.6-6.7. These particles were able to lyse listerial cells. DNA sequence homologies between chromosomal DNA of monocin-producing strains and labelled Listeria phage DNAs were inferred from DNA/DNA hybridizations, suggesting that most of the prophage DNA is still present in the listerial chromosome. An endolysin gene cpl2438 was cloned from listerial chromosomal DNA and was identified by its expression of lytic activity against Listeria cells in a bioassay. The gene consists of 864 nt encoding a protein of 287 aa with a calculated molecular mass of 32975 Da (CPL2438). This is in good agreement with the size of a protein observed in SDS-PAGE after overexpression of the lytic protein in Escherichia coli. The nucleotide sequence of a putative holin gene (hol2438, 291 nt) upstream of cpl2438 was determined after PCR-amplification of listerial DNA and it shows typical features common to the holin gene family. Expression of the encoded protein (HOL2438, 95 aa, 10.1 kDa) in E. coli was found to be lethal for the host cells. The results underline the close relationship between monocins and intact Listeria bacteriophages, indicating that monocins are incompletely assembled phage particles derived from cryptic prophages of Listeria, probably including the phage lysin. [TOP OF PAGE]
contents | bacteriophage ecology group | top of page
Contact Steve Abedon (microdude+@osu.edu) with suggestions, criticisms,
comments, or anything else that might help make this a better site.